Description :
From Genome Similarity Track
Location :
contig_163:5811- 7690
Transcript NameFunction/comments
g14487.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1879 bases(100 bases per row)
CCTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCG
GAGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGAC
GCGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGA
AGAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGG
TATGCGTCGCAGAGTCGACACCAGACTCTGGACGAGATGTCGGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAG
AAATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACAC
GTGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAG
GCGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGA
GTCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGA
TGGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGAC
GACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTTG
ACGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTA
CTTCCTCGGGATGGAGATCAAGAACGACCCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAG
ACAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCC
GTATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCG
TGTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGT
GCGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAG
CAAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGC
GAGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACC