Description :
From Genome Similarity Track
Location :
Scaffold_2:5811- 7647
Sequence
1836 bases(100 bases per row)
TGACGCTGGCCCAGCAGCGCATTAAACGACCGAAAAAAGTCGGACATGAAGCTCGGTTCCTGGTCGTGCCTGATTACTTCGCTGGCTCCGTACCGCCGAA
ACACGCATTCCTCGTATGCCTCAGCCACTGTTGGTGCGGTCCTGTCCGCGTTTGCCTTTGCCACAACGAAGCCGGTGAAGAGATCCACGAAGACTAGGAG
CTCTGTGTTGCCCTTGAACGACTTCGGGAGGGTGGGGATATGATCCATAGACACGACCTGGAAAGGGTAATTAGCGGCGATATTGCCCGGCGATCGCCCC
CGCAAGGTGGGGTTTCCTTTTCCCGTCTCGCAGCCGACGCACTCCCCGACATACTTCTGCACACTTCGGAACATACCTCGCCAGTAGAAATGCCTCCAAA
GCTTTTGGAATGTTCGGCTGACTCCCTGATGACCTCCCTCCACACTTGTGTGGAAATGATGCAGGAGATCTTCGTGGAGTGTACTCGGCATTACCAGTTT
CACCATAGATCCACGGTCCTTGACATCACCACCGCGCCCCTCGACTGGACAGTACATCAAGAGACCATGCTCGTCGACCTCGTAACTGTCAGCCAGGTTA
CTGCACGTCTTGGCTTGACGGCTCGAGATCTGAGAGAGATCACCGTGCAGGAAACACTTCAGTGACCAGATCCACACCTCCTCGTCTTGAGCACGGCAAA
TACGTTCCAAGCGCAGCTGCTTGACGACGTCTTCCTGCAACACGGCTGGTACGACAGTACGAGATCGGCTTCGCGTGACAGCGCCTACCTTCGGATGGGC
GTCACGATCTTCGCGCGTCTTGAGGAGCTCGTCCAGTCGATTCAAGGTCTCGAGGTCTGTGTAATCGGTGTGACTCTCGACAACTACCCCGGCACCACGC
TGCAGCGCCTGTCCCACCAGCATATCCGCGGGTTGGTTCCAATCGCGTTTTACGTGGATGAGTTCGCATTGCGGCCAAGACTCTGGCCTTCTCACGCAAG
AGCTGGAGTCCCGATGACTTGCACTCCACCTCTCCACGCAGTTGGCGGATGACTAAATTGGAGTCGCCACACACAATGAGACGGTCGATCTGGAGATCGG
CAATCAAACGAAGTCCGAGAAGGAGGCCATGGTACTCGGCCTCGTTCACAGTGAGGTCCGGTAAATAGCCAGATTCAGCCTTGACAACCTTCCATCCAGG
AGCATCCCATACCACAGCGCTGAAAGCTCCACCAACTCGTTTCGGCTTGGCCGATCCGTCAAAGCTGACGACGCAAACGTTTTCTCCGGGCGTAAAAGTC
GGCATCGGGATAGCCAATGCTCTCGTCGACTTCTTCTGCGGAGAGATCTCCTCCAACGCTGCATCCATCTCTGCGCGCGGAGTGATACTGGCGGCAACCA
AACCTAGTAGCTCATCTTCGCCTTTCGCTAAACGTTCGATCTCTAGCGAATGGGGGGAGAGCAGCGCCACCCACTGAGCTAGCCGTCCCTTCAAGCCTTT
CGCGCGGAAGAGCCATGCGAGAATCGTGTGTCTGGTGAGTACTCGGATGTGTCGACCACTCAGCATGGTGAAGCAGCTATCGAGGATTCTTAGCAGAGCC
AGTACTTCCTTCTCCATAATGTCGTACCCGATCTCGTGAGACCGCAGTGTCCTACTCGTAAATTTGACGGGTACGTACACTCCATCACGACACTGAACGA
GAGAGGCAGAGATCGCCCACTTGCTTGCGTACACAATCACAACAGGATCCAACTCTGGGGCAAAATGGTAGAGCATGGGTGCGTTGATCATCTTGAACTT
CAGGGTGTCGAAGGCTCGTAGCGCGTGGCCCCATCT