Description :
From Genome Similarity Track
Location :
Scaffold_162:58102- 61873
Sequence
3771 bases(100 bases per row)
TTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGA
TGGAGTCCGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATTTGGATGGCCCATCCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCG
GGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTAAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAAC
ATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTCTCTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAAC
TGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGAC
AATACTACCATGCTTGCCGCAGATCGGATGAATCCCCGTTAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGG
GGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTGGGAGACGTGGATCTGGCCGACAGGCTGGCCCTGTTACGACTTCCCGACGCA
GACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGC
CTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGCCCGACTCAGGAACTGAATCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCG
AGTCTGTCTCACTGCGTCCAACGATCGAACGACGAAGACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGA
GATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACCACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAACACACGTGATCT
ACATAAAGTGTCAGTTGCCAAGATCTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATTCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCA
CGTGGTTATTGGGAGAAGTGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAGGTCACTGGATCCC
GTGGATCTGAGGATGTTGGATTTATGGATCTGCTAATCGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGT
AGGGGGCAAGATCACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATATTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAG
TGGATGAGAGTCGGATGCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATAGGAGAGCGCGGATCAAGATCACGCTGGCAGGTTGTTTGGT
GTACTGGTTCGATATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGGATTTGGCTGAT
AGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGGGCGAAGATGAGGATCATAGAGCGGATTAGACAACCTG
GACCGAGCCCGGGGAAACCTGGGAGCTGCCAGATAGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGTCTACCGGA
ATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGA
AGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGACAGAATCTGGCGTACGAGGCGACTACCGAGATCGAGTC
TCTCGGAGAGGTGGAACTCCCGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAGCTCCGCGAAAGATCCTGCAGAGAAATCGTCGGATC
GAGATCCAAGCGATGGAGGTTGGATCCACGACGGGGGATGATCCCCAGAGTCGTCCCCTAGATAGCGCAAGATCGGTGGATGAAGGATCGCAGAGGGCTG
AAGCCGGACCGCCAGATCCCGCTGACCCCAGAGTGGGTCCTAACTTTGCATGGAGCAAAGTGCCTGGATCCTTATCGAGAGTGACAACACTAGTCAAACC
AGAATCGTCGGGTTTAAACTCGCTAGAGGATCGACTAGATCCAACCGGTGGCTTCCCCGGTACCAGGGTACCTGACCCCATGAAACCAGAAGGAATGACG
GGTGAAAGAGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGACGAAGACTGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGG
ATCTCGGAGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTTACGATTGACGACATCCAAGTGGATCTAGGGGCGAACGAACCCGC
GGAAGTGGATCGACTACGTCAGAAGATCTGGGAAGGCCGACACCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGAAATCAAATGTGAC
ATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGTACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAG
CCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGACT
GGTTAACAGCCTGACTCGATTGATGGTGTATCCGATACCTCTAATCAATGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTTGACATG
GCCAGTGGTTTCTGGGTAGTTAATATGACGGATCGAGCTCGCGCAATATCCGCATCCATCACACCGTTTAGACTGTTCGAGTGGACCCGGATGCCGTTTG
GATTGAAGAACGCCCCCCAGATCTACCAACGCCTGATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAACCCGTAAAGGGTGGATCCGGGGAAGA
TCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGGGGATCCTGGGACCCCGTCTGTGTTAGGACGCAGATCTTATATTGACGACATTCTAATCCCG
GCAGAATCGTGGGATCAGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGAAATCTCTC