Description :
From Genome Similarity Track
Location :
Scaffold_1270:5810- 9308
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1270-snap-gene-0.3ATP-binding Cassette (ABC) Superfamily
Pytar_ATCC12531snap_masked-par_contig_1270-abinit-gene-0.10Conserved gene of unknown function

Sequence
3498 bases(100 bases per row)
ACGGCGCTTCCCGCCATCCAGGCCAAGCCCAAGTACGCCAAGGAGATCCCGAACGGCAGCGGCGTCGCTGGCGTCACGGCCGTCGGTCACACGGACCCGG
ACGCCGGTGGCGCGCTCAACGCGTTCGGCAAGGCCTTTGCCGCTGCCAGCAACGCCTGGACTGAGGCGCTGTGTAAGGCCGACTCGGACGGCGACGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGAC
CCGGGAAGTGCCACGTCCAAGCTCGACGACGCTGCGCTCACTGCTGCCCGCGCACTCTGCAAGGCCGCCGACCCCGGCACGGTCAAGCCAGCGGNNNNNN
NNNNGGTGCGAGCAACGCGACCCCCGCACTCACGCCTGGTGCACCGGCATCCACAGCTCCCGGTGCGGCCCCAGCGGCTCCAGGTGCTGTCCCCTCCGTT
GCCCCTGGCGCTGCCCCTGGCGCTGCCCCCGCTGCTGCGACTGCCGGTTCGGACGGATTCGACTGGGTGCCGATTGAACAAGTGAACAACAAGACCAAGA
GTGGCTCGTCGACGGTGACGGCTCNNNNNNNNNNGACGCCATCGACGGCCACGAACTCTTCCAAGAACGGAACGAACTCGTCGTCGGCGGCGCTGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTCGGCGCGTGGCACGCTCGCACAGGTCATGGCCGCCACTGT
CGTGGGGGCGATCGCGCTCGCACTCTAAGCCTCCGTCCTCCATTTCTGTGTGAGGTGTGTATCTGACGCAAGTCTTCCGTGTCTCTGCTGCCCGTGCAAG
TGTTGTCGGGCGGTCGAGAGCTTTCCACCCGTCGGAGCGTCTCTGGTCTCCGCTCTCCCTAGACGCCGTGGAGAGACGAGCAAAGCGCGAACGCCGTTTG
TCCATATACAACGTACTAAATACGACGCTCATTATATTGCCTTGTCCATTCCTTCTTCGAGTGTGCCGCATGCGCAGCCATTCTTGCATGCATCGCCGAG
GCGTCTTATTCGAGTCACGAAGGGTTCTTCTGTGGAACATTCTCGGTGCGATGCACGAGCCGCCGCGAACGAGAACAAAAAATAAAGTGTTCTCGCGCGA
GAACAAAAATGAAGTGTTCTCGCCCGAGAACAAAAATTAAAGTGTTCTCGCCCGAGAACATTCTGCAGTGGGACATTTCCGATCGCATCTGGTGCTGCAG
CGCGTGACGCGCTTCATGATCCCATGGCGGGACGGGATCCGTTCGTCTTCCTCCCTCCCCACCATCGCACGACACGGGCTCGGTCTCTGGGCGTCCATTC
CCCCATTCCATCACCAGCGACGATCCATCCAGCCACGATGGCAACAGCGGTCGCCGTGCTCTTGCTTCTCTCGCTCTCTCTGGACTTTGCCGAAGCGCGA
CGCGAGTACGTCGGGCGCATCCCCAACGGCAACAATGTCGGCGCGGCCCACGCGCTGGGCCACATCGNNNNNNNNNNNNNNNNNNNNNNNNNNGTGGGAC
GGCGACGGCCCGCTCAATGAATTTGGCAAGGCGTTTGCGGCCGCCGGGTACACGTGGACCAAAGCGCTGTGCCAGGGCGATGCCGACGGTGACGGCCAGA
CCAACGGCGAAGAGCTCGGCGATCCGTGCTGTGTATGGCGACAGGGAGACGCCAAGCCTCCGCTCGTGACCAACGTGCTTTCCCACCCGGGCGACCATGG
AGCAAAGCTCAATGAGACCGACTTGCACGACCGGTTGCGGATCTGCCAGACGCTGCTCGCAGCGAATGGACCACAAGCGACCGGAAGCAACAGTTCATCT
CGAAGTAACAGTGCGGGAGACTCGGATCGAAACTCCATTCACCCACCTACGACAGCACTGGTGCCGACACCAGCATTATCCTCCGCTGCGACAGTGGATC
GAAGTTCGGTTGACTTGGGAGTCACACTCGCCGTCACCTTCATCCTCTTTGTCGCCGTGTAGAGAATGGTCGTACGCAGCAGCATGCAAGGTGCTTCCAT
TTTGAGTGCACTTTGGTATTTATAACGTCCATTCCCTGTCTTCTCTTCTGGAAATCCACCGAGCATGAGTGCACATTTCCCCACACAAGAAGTACCATTC
TATAGACTGACTTCACCTCCTCAACATTGAACCTACAAACATGCCCCGCGAGCCTGCGCAGGCCAAGCATATCTCCCACGTGCAGCTCGAACTCGAAGCG
TTGCTACGGTTCTTCGAAAGAACTGGCGGCCCCAAGGGTGCGTGGATAAACGACACGGGATGGGCTGCCCTGAAAGCAGCCGTCGAGCAAACTGGTGATA
TGATCATCTTGCGAGGATCACTTGAGAAGCAGCTTCCGCTCTTTGGCGTGCAGTGGGAGCGAAACCATGTTGTCGCCATTGATCTCTGTGCCAACGGCCT
AGACGGCAGGCTGCCCAAGGAGCTTGCCACTCTACGGTCCTTGAAGCAACTAAAGTTGCGTAACAACCCAAGACTGCGCGGTCCCGTACCGTCCGCGATG
TACCGGATGCCTCGCCTCCAGTACTGCTACCTCGACGGCACGAAACTGGAAAACGTGCTGCCACACCACGACGCCCACGCCTTCCAGATCACGCGACTGG
GCTCGCATGGTACACAGACCCACGTCGCAACCGTCAGTTTTGCCACGAGCAGTCGCGAGGCAAACTTGACACGGTGGATGGCCGACATGACTGAAGCCGA
ACTCTTCATGGTGCAGACGACGCTGCAGGCGCGTCACAAGCCACACGACGTGCACGAACCTTACACACCGCAACGTACAGCATCAAATGCCACGGGGCCG
GAACGCGTCGCCGCTGCAATTACCCTGCAGCGCATCTACCGCGCTCGGATCGCACGCACACAATTCCGCAACTTTCTTAAGTCGCTCTTCCCCAAGCATT
TCGACGCGTCGACAGGACTCGAGTACTTTGTCGACTCTCGCACGGGCGAATCTATGTGGCAGCGCCCGATCTTCGTCGCGAAAACGCCGCGGAGTGAAGG
CGAAGACGACAGCAGCCAAGATCTGTGGCAAGCGTTCGACGACGGTCAGGGAAACACAGTAAGTCTTAGGTGCGCACGCTTTTTCATACCTGTCCATTGA
TTCTGATGCGATGGCTTGTGTCGACCCACCGCCAATGCAGTACTACTGGAACAGCGTCACGGGCGAGTCGACGTGGGAGCCGCCCGCCTTTCTCTCGCGA
ATCTATCGAGAGCTACGCGATCGGTACGGCGCCGAAAAAACCGACGACGAGCGTTTCGAGTTGTTCTTTCAGGATATTGATCGAGACAACACAGGCTCGA
TCGATCGCAACGAGTTTGCGCGCTTGTGCGGCGAACTGGGAATGGCGATGTCACCCAAGCAGATCAACCATGTCTTTGACGAGCTGGACACGAGTGGG