Description :
From Genome Similarity Track
Location :
Scaffold_2955:581- 2590
Sequence
2009 bases(100 bases per row)
CTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCA
GTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTTGACGAAGTGGTAGTGGTTGG
ATCCGGGAAAAGGACAGTCCAGGTGATGGCTGTCACTAGGGTCCAGAGGAAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAAACATTTGTGAAGAGA
GTCCGCATCGAGCGGATCCTTAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAG
ATGCCAAATCCTACAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCAACGAGGACCGGGA
TGGATTGATGAGACTGGTGATGCCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGCATTGGTCGGACC
TACCAACGGATCCGGGAATGTTTCCATTGGAGAGGACTATTCAAGAGTGTACAACGATATGTCGGTGAATGCGTGGATTGTGAGACAGGCAAGGGCAGAC
CTACGATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAGATCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCGTTCAAAGG
AAACACGGAATTGTTGATTTGGGTGGACCTGTTTACCGGATATGTGATTGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCCGAATCGTACGAG
GAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAGCCGGATCCTGG
GGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATGTACGTCCA
GGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACACCATTTTACTTG
GTACATGGGTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGCAGTACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCC
AGAAATACTACCGGCAAGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCA
AATCCAAGTGGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTACTGCATGGATCGTTCCGAGTAAGT
GAGAAGATAGGGGAACATGCGGTGAAGTTTGAAACTGCAAGTACCGAATATCACTTGTTTCCTGTAGTACACGTATCCAAGCTGAAGCTGGTCAAGGAAT
ATCCGGACCGGCCGCCAACCCGCCTTTCGGTGGATAAATCCAACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGA
AGCCGACGAGTTCGAAGTCGAGAAGATCATCGACATGAGGTCAGGGAAGCGAACTAGGTACGGACGGATTTACCGCGAATTTCTGGTGTATTGGCGCGGA
TATGACGAGCCTATTTTGGTAGACGAGGCAGATCTGAGCTGTGGAGCATTACTCTATGATTTCTTGCGGGATCGTACGAATCGGAACAGATTCGGCGTGA
TGCAGTCTCATGAAGAAGAGTAGGGAGAGGAGCCATGGGTGTGAGTCGGTCATGTCGATGGGAGGATGAAGAAGGACCCCCAGGAAGGGTGTGGGTCAGG
AGGAGGAGG