Description :
From Genome Similarity Track
Location :
Scaffold_1:5809107- 5812710
Transcript NameFunction/comments
Physo_468609ATPdependent DNA helicase putative
Physo_345432serine protease family S10, putative

Sequence
3603 bases(100 bases per row)
CGTGTGAATTCTGCCGAGCTTCAACTCGCCGCCAGTCGACGCGATCACATCGGGCCGCGGACCGCGGGCGGAGATGGAGCGCATCTACTCGGCCTTCTTC
ACGTCGGAGCGGCGCCGCGAGCCGCAGGAGCTCACGGCCGCGGCGCTGGAGCTGCACAACGAGACGCAGAAGGCGCACAAGCCGCTGCTGCCGCGCCCCG
GAGCAGACGGAGGCAGGCGACGGCCCGACGCCGATGCAGACGAATCCATGGCCGACGCCAAGCGCCACGCCGCTGCCAGACGCCAGGACCTCCAGCAACT
GACGATGGACTGGGCCAGCGTCAAGAAGGATCTCGAGGCGGCGTGCCAAGCGGCGGCGAGAGCGTTCCTGTTGGCCTACGGAGCTAAAGCCTTCACTGCC
GTGCTCCTGGCCTCGAGGAAGTGGAGCAGCCTCGAGTACGGCTATGCCGATGCTGCCAGACTGCTGCTTAGAGGCGACACACTCCGCTTCGGGGCTTTCT
TCGGGAGCCTGGTGGGGATCTTTCGGGTCACGGAGCTCGTGACTCGAGCTGCTCGAGGTGGACAGCGAGACGCTGTCAACTTGGCAATCGCAGGGGCGGT
CTCTGGGTCGGCTCTGCTGCTGGATTCGCCCTCAAGACGCAACACCATCTCGCTGTACATTTTCGTCCGCATGCTGGACGTGGTGTGTCGCCATTTGATG
TCGATCGGTGTCTTACCCACGTGGCGTTACTCGTCGGAGATGCTTTTTGCCGCCAGCAATGCCGCCATTATGTATGCGTTTATCGTGGACCCGAGCTTGT
TGCCAAAGGTAACTTGCCTCTTCAATTTCACCGTCGTGGCGGGGCACGTAGGTGGGATACTGAATGTGTTTTGCTACTTTGTGTGTGGTCCTACCAGGGC
TACTACCAGTGGATCTGCCGCATTGGCGCTGTTAACCACCACGGTCTGGAGTACACCGTGCGCCAGCGTATGCGGGGCCAGCTAGATGCGCACGGAAAAC
CACTGCCATTTCGCTTGTGTCAACCGCACTACCACATGTACGCATTTGGAGCTGGAAGTCGGCTCGAGCGACGAGACTAACGTTGCTGTGTCCATTAATG
GATTAGGGAGTCGTGTGTGACGCACGCCATCAAGGAGTGGATCAATGGCTTGGGACGGTCAATGCAGATTTATCTGCCTGTGCACTTCCTCCCTGCTATG
TTCTTCCGCTTCCAGCACCTTCAAGGGGCCCCAGTGTCCACAACTGCGCGTATCTCCTACGCGGCACTTTGCTCGTCAGCATTCCTCACTTCGTACCAGG
TCCGTTTGTGTTTGCTGTTAGTTGGCTTGTGACAAGAATACTGACTCCTACGGATCATTGTTGGGGATGCCCTTTCAGACCGTGGTGAAGCTGGTTATTT
GCACTGCTCGCAATGCCTTCCACCGAGATTTCGCCGTGACGTCGCTAGCTGCCGGGGTAAGTCACTAACTCGTCTTGCGTCGGTCCACATCTGCTGAACT
AATGGGTGTGCGTGTACTGATCAGCTTGCAACGGGTGGCGCGCTGTTCTTTGAGCACACTAAGCGCCGCTTTGAGCTGATGCTGTACTGCTTCCCACGCG
CGCTCGACATCGTGTGGCAACTTTTGAAACGCCGCGGTCTCGTGCGCTACGTGAAGCACAGCGAGGTGGTATTATTCTGCCTCTCGATGTCGCTCATTAT
GTCGAGCCCAGCCCGCCATTTCAAGCCGACGTACCTTCGGATTCTGCGATTCATTTTTGGCGGAGACATCATCTAAAGGATTGTTTTTAAAAAGGCTTGA
TGCACGAAGCTTGTTGCCGATAGTTTTGATGATTTCACGCATTCCGACTTTCATTTGAACATTAGCACTAACTCGCGCAACTTTTAGTAGTACTCCAAGT
CGTTGAGCACGAACAACTCAAGCATTTGCTTGGCCTTCTCAGGCTGGTCCATAGGCACGAGATGGCCTGCCCCCTTCACAGTCACGTACGAAATTCCCTC
GAAAGCCTCCACAAAGCCACCCGTTTGCTTCGAGTCTTTCTCACCATAAGTCCAGACCGACCGCGGCGCCACGCGGGGAAGACCCAGCGACTCCACTGCC
CACAGCCCGCCAACAGCATTGCAGACCAAGTCTGCGTCGCCGTGATAGATCACACCTTTCACTCCGCTTTTAAGCAATTCGCGCCATAACGGCGTCACCT
CAGTGTTCAGGGTCGGCGTGTACTTCAACATCTGGGGGTGCTGCAGCATGGGGTGATCGACACCGAGGATGGAGCCTAGCGTTTCCATAGTTGCAGTGGT
CAACGCGTCGCCGCTCCAGTGTGCTAGCGCTGGGTTAGCATGCATCGCGTCGCGAACCTCAGCCAAATTGAAGTAAGATTCGAGGTGCTTCGTGTCCAGG
CACAAATCCATCGTGTTTCCAATCGGGTGCGGCAGCTTGCCCGGAGTCGACGGCGTTAAGATCTCCTTCACCAGGCGTTGAATATCCTCCTTAGGCGAGC
CAGCACACGAGCTGTAGACGTCGTACATATTGATGCGGTCATAGACCAGCGTTGAAAAAACGTTCATGGTGGCGGTCGTGCACTCCGAGCTTGCGTCACC
CAGGCCAGGAGCGACAAGGGTGCTCTTCTCAAACTCGTGGAGGTCGGGACAGCTAGCTCGGTATTTCTGATACTGATCTGTGCTGAGGAGTCCGTGGTAG
TACGCAGACATTACAGTCGAGAGTCCCATATACTCGTTCACGCCATTCCCCACCACGAACTTCTTCAGGTTAATGCGCTTCGCCTTCTCAGTCGTAGCTG
CGTTTCCATTGACAATGGCCAGCGCCGTAGTCGGCACATAAATTCCACCGTAACTCTCCCCCGACACAACAAAGTCGTTCTCTCTTAGCCACGGGAACCT
CCCAAAGAACTTCTGCAGGGCGTCGTACAGATCCTGAGCCTGCGAGAGGTCATCGGCTTCGTAGACCCCACTGGAGTTGTAGCTAAATCCGACGCCCACC
GGCGACTCGATGCACAGCAGATTGGCGCGTTGGTTCCATGCAAACTTGTTGGCACGGAGCGTTTTGCCGTCCATATTGACCAGCAGCGGCCCGTTCTCCG
AGAAGCAGCCGGACAGCGAGCTGGATCCCGGTCCTCCATTGAGCCACAGCAGCACGGGGTCCGTCTGGGGCGTGGAGCTCTGCGACTCGGCCAGGAAGTA
GAAGGCGTGACCCCCGTTGTTCAGCGGCAAGTAGCCCGAGAAGAGCCGCGCGGTGTAGTCGCTGGGCTTGCCCGCCAGCGTCAGGATCTCGTCCGAGAAG
CCCGCAAAGGACTCGCGGGGCAGATCGGGCGTCTCCGCGTCGGCCGAGTCCTCCATGACGGTGGGCTCGGGCGTGCGCTCGCCCGTGCGGATGAGGTTCT
CGGTCTGCAGCGAGCGCTGGAGCGTGACCATGAGGTCCCCCACGGCCAGGAACAAGAGGCACGCGACGCCGTAGCGGATGAAGCGCCGGCCCGTCGAGGA
CAGCAGGCGGCGCGAGCGCCCCGCGGCCGGCAGCGTCTGGCGGGAGCGCAGCCCGCGCGTCAGCGGCAGCGTCTCGTTGAGCGGGTCCGAGCGCTGGTAC
ATG