Description :
From Genome Similarity Track
Location :
scaffold_5:580820- 582542
Transcript NameFunction/comments
g8220.t1 hypothetical protein PHYSODRAFT_349537

Sequence
1722 bases(100 bases per row)
CACCACGCAGTACCAGCGCTCCATCTTCGGGTGCGGGAAGCGCGGGGCGTACACCAAGTCGCACGTGTCGCCCTCCTTCACGTTCTTGCGCGTGAGCTTG
ACGGTTACCGTCATGATGTCGCCCTCGGCAATAAACTCCTCGTCCTCTACGCCAATCGAGATCTGCAGCTCCATGTGGGGCATCATCTCCAGCACGGTGT
TCACCTCCGCGCGATTTTCCTCTGAGAGTCCGCTCAGACCCTTACGTTCCTCCGGCTTCATGGCAATGTACTGGTGCATGCTACGCACAGCGCTCTTGCC
TGTGACAATGTGTTTGACCTCAGCCTCCGTCATGTGAGGCAGCTGCAGGAACGGCGGGTCCTTAAACCACAGTCCCTGCGTCAGGAACTGCTGCAGCTCC
ATGAGGTTCAGCGTGGTCTGCAGCCACGACTTCATGACTGAGATCTCCAGCATACCGTCCACAAGCTGGATACCCTTCTTCAGCATCAAGCTCAGGTCTC
CCTGCAGCGTGGGGCTCAGCTTCTCGCGCAGGAAGTGCGCGTGCAGCAGCAGGTTGGCCTTGGCAATGGACGGGTGGTTGAACTTGGGCTTGGCCATCAT
GTCCGACTGCTTGAAGCGCTTGAAAAGGCCACCGAGTTCCGCATCATCGGTCGCGCGGCGCGGGATCTCGCGGAACTCGGCCGACCCGGCCAGGATCTCG
GGCAGCATGCGCGGGTGCGAGTGCTGCGACATGGCAAAATTGTAGAAGCCGTATGTGTCGTACATGATCATGCTGTCTCCGTACTTCTTCGAGTGCGAGT
ACCAGAGCGCCACGCAGCTCGGGATGGCCACAACGAGGATGATAAGGTACAGGAAGAGCACAACATTGTGGTTGGCCGGGTCCAGCAGGAACGTGGGCAG
GCCGATGGACAGCTGCAGCGCCTGGCGGCCGTCCGGGTTGCCGAACTTCTCGTAGTTGGCCTTGGCCACCTCGTCCGTGAGCGCCTCGTAGGCCTTGGCC
ACGAGCATGAACTTCTGCTCGGCCACGGCGTCGCCCTGGTTCTTGTCCGGGTGGTAGAGCAGACTCATCTTGCGGTACGCGCGCTTGATCTCGCGCTCCG
AGACGCCCGCAGCGATGCCGAGGATGGCGAACGGGTCGAACGACTTGATCTCCGAGTCGTCCTTGAGAAGCAGCGCCATGCGCACGAGCGCGTACCACAC
GGCGGCCAACACCAGCAGATTGAACACGAAGGGCAGCGAGAAGACATTGCGAAAGGCCGTCTTCTCGGCCTGCAGCTGCTTGAGCTTGCGCAGCTCACGC
TCGCAGCGCACTTGGCTCTTGTCGATGAGTCGGTCCTTGAGGAACACGCCATAGACGATGCGCCGCAGCGACAGGAACGTCACGGGCACCGCGTACAGCG
CGCAGAGCGACACCGAGAAGTAGTAGAAGGCCGAGTTGTCGTACTCCAACATGGCGGACGATAGGCGAATGGCTTGTGGCGAGGATTATGGGGAGGCACG
ACACGTGGAGCTACGGAACCCAAAACAAGCCAAAAACGGATGGCCCTCTCTATGAGCAACGGATAAAGATATTTGTATTAACGGTTGCGAAATGAGGGGG
ACTGGATAATGTTTTGGGTTATCACGATATTTCTGTTTTGGGTTCTAGACACAGCCATATTGCTGCGGACCCTCTCCCTCCACTGCTGCCACGATAGCAT
GAATGTCTTTTATCGGTCATCT