Description :
From Genome Similarity Track
Location :
Scaffold_6:58079- 59113
Sequence
1034 bases(100 bases per row)
GGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCATGCACCGCGTCGTTGAGCGCAAACTCAGCAACTGGAAGCTGCGTCGACCACG
TACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATAGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTAGACAT
CTGCAGACGAGCTCCCAGTAAAGAGAACAGCGTTTTCCAGAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCATCTCTGGGAGACCGTGATAG
CGGAACACGCCATCGACGAACAACCTTGCGATTTGTTCGCCCGTAACAGTGACGGGAACCGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACA
CCAAAATTCCGGTGTTGTCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACAGGCAGGCTCTGGAG
TGGAGCCGAGGAGTGCTCTGCGGGTTTGACCCGCTGACATGTTTCCCATGTCTTAACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGAC
TGAGAGACCGACGGAAAGGTCTTGTCGCGGCCAAAGTGGCCGCTGGAGGCCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGG
GTACGACCACTCGTGGAGGTTCATTGGGCTCCTCCCGGTAATAGAGGAGGCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAG
CCAGTCGGTCTTCGCGCTCGTTCCTGCCATAAGGAACTTGACAATAGGCGCGACAGCCTCATCGTTCCGATACGCCATGCGTATCCGATCATATAGATCC
GTTGTCACCCGCGTGATGTGGGCCAACACATAGTCAGGACGCCGGGAGAGGACGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGT
TGTATTCCGCGAAGAAGGACAGCCACCTCGCCAT