Description :
From Genome Similarity Track
Location :
Scaffold_1516:5807- 7784
Sequence
1977 bases(100 bases per row)
GAAAGCCAATCACGCTTTCCCAGCGCAGCAAACGACGCGCGCGCCGACCGCAACGCGGCTCCATGTGGCCACCGCTTATGGGCCTTCCTTTTTGATGGCG
ATGGACAGCGACCTTACTTTGAAGCGACACGCATGGCACTCAAACTCAATCTAAATTCACGTGAGGGACTGCACAGGCAACGCTACAGAAACAAAGAGAA
GGAGCAGCGCATGCGCACAGCAGGCTACACTCAGCGCCGCACATCAACCGCGCGCGGTCCTGGACGAACGCAGGCGCTCTTCTTGTTCTTCTTCAAGCGA
GCTTCTTCACGAGGAGGTCGTATTTGTGCGCGTGAAGACGGTTTTCTTTGTTGTCGTCGCTATGGTCGAAGCGCTCGTTGGTGGCTTCGTTGTCGGGGGG
CGGCTTCATCGAATCAACCAGAGAGAGTAAATTTCAGTCAATACCATCCCAACAAGCGCTATTAAACACACATGAAGCTGACGATCCTTCAGCCTGCATT
CTCTCAGACCGAGCTGCTCGCCGCTCCGCTTCCCTTTCTCGTTCGGCCTGTTGCTGCAACTTGAGCACTACCTCGGGCTTCTCGAAATTCATCGTGTCAA
GGCACCACACGCGGAAGAACGCGGCAGGGAACGCGACGATCATGTGCACTTGGTCCAGCGAGAGCTCCCCGCCCACAGCGTGTCTTTGTTGAAGTAGTCG
TACACGAAGCGGTCCTCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGA
GCTCCGGCATCGTGTATTTGGCTGTCAGCTCCTTGAAATAGTCGAGGCGGATGAGCTCGTCGACGTCCGGGTCGTCGCATGTGAGCCAGTCGCTGCCGTG
CGACGCCTTCTTCGCCAGGTACAAGCGCCGTCCTGCGTCGCGCACTCGATCTTCTTGTTGAGCCGGACCTTCTCCTTCAGCGCAGTCACCGACCGGTTCT
CCTCCAGGTCCATGTACATCGATAACACGCCCATGCCGACGGAAAGGATCTGCAGCGGCTCCACCATCGCCTTCAACGTGCGAAATCGCATCAAGTCAAA
ATTTGCAGCGCAAAATGCACATCTGGCTGACCTATCAAAAACACTTTTTCCCTCTCTTTTGACACAGAGATTGGGTGTTAAAATACAATAACGTTTTGTA
GCTTTTGTCAAAAATATGCGACCTATAATTTTTAGTTTTTAGTTTTGTTTATGCCGGACTGTACAGAAAACAATACATTCAGCATCGATTACATGGCTGC
GAAAGCAAAGCACCACAAAATCCCTATGCGCTACGCGTGCTGCACGTGTGTGCTCGTCAACTGATGGCTCTGTGTGCTCTATGTGCTCTCGAGTTGAGTT
GCTTTTGCAAACTCACGCTGATGGAATATTGCATCATGGAGTTGCAGCTTCAAACCTACGAAGCTACAGAAAACTGGATGTCCGACCAGAAAATCAAAAC
CTCTTGGCCTGATCTGACATCAAAGCTCAAATGTGAATCACTCCAAAGAATCCCTGTGTCTGGTTCCGAGAGTTGATGCACTGATGCACTTCGATGATCT
GTGGAGGTCTAATCGCTCACCTGTTGCTACCAGCTACAGTCAGATTTTCGCAGATCCATTTCGATCCGATCGAGGTAGGTAGACATGCATTTTCTCAGTC
TTAATTCCTTTAGTTCTCTGTGTAGAAACATAGATTCAGGAAGCAAATTATGCGAATTAACAGGTCACCATCCTGCACTGTTCCAAAAAGAGTCCGAATG
GGTACAGTTTCGGCGACATCGATTTTTGTCGATTGTTTCCCCTTTTAGTAATAAAACCCCTCCAACTAATCAATTAA