Description :
From Genome Similarity Track
Location :
Scaffold_237:5806- 9696
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19972hypothetical protein

Sequence
3890 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGGCTGGCAAGCCGGAGGCGAAGCTGTCGTGCAGCGCGCGTGATCTTCATCCGCCGGGCCA
CATACTCCCAGGTGATACGAAGGCCCTCTCTCTCGAACTGAAAAGCGACCTGAACCAGGAGTTTGTCTTCAGCGTCTGAAAAGCTTGTGCGCATGTATGT
AGAATTTACTATGGAGAAAATAGATAGTCAGACAGGTGCATTTATCTAACTTTTTGTATGGTAGAGTGACTGGCTGCTGAGCGCACGTGGAGACCCACAC
TGTTTATGCCACGTCCACAGCCGCGTGACAGCGCATGATTACGGCAGACAAGGCAATAAAATACTACTTAAAGGAGCTGACAACCAAAATTACTCCCAGC
CCCTTTGCGTACGCTGCATTGATTGTAGTTATAATATAGGGTAGGAAAAAGCTAAAAGGGCGAAAAAATCGCCCTTTTACAAGGGGGTTTCTCACCGTGT
TTTGAAAACAGTGTTAAAGGGCGAAAAAAGCGCCCTCACACCGCGAAAGGGTTAAAGGGCTTTTTAAGAAATAAGATGCGCTGTCAGTTATGGAAAGTTT
AGAGCGTACCGTAGTAGCACCAATTAGAACCAATCATTTTTGCGGAAGCATGGACCTAGTCTGCTTTCACTATGCTGCGGCCCGTCCCGCTCGTTCTCGG
CCGTCTTGCTGCCCCACTGACGCCCTCCCTCTGTTCATCCTCCCTCCCTTCTGTGTGCGTGTACAGGTGCAGGAGGTGGCGATGACGGTGTCGTTGGCGT
CGGAGGTCATGCCGGAGGCGGCGGTCGTGGTGCTGGCAGTGGCAGCGGCGCTAGACAATACCACGTCCAGTCTGGCAATGGTGGAATTGATACTGGTGGA
TCTGTGGCTAGTAACGGCGGCGGACGTGGTCGTGGTGACCGTGGTGGCCGTGGACGAGATGCTCGTAGTCGTGGTGGTCGAGGCCGTGGTCGTAGCGTTG
CACCGCGAAGTGGAGACGAATGTGAACGTAAACAGAACGATACTGGAGACTCACGTGACGAACCTGGAGCTGTTGGAGAGCACCCCACTTCCGCTGGATT
AGGTACTCCACCACGCACCACGCCACCTCCCATGATCGAACAACTTTTTCTCAAAAAGTACGTTGCCTTTGCACCGTCCAAAGAGCGGTGGATGAGCGAG
AAAACATTTGGATGTGCGGGCACGGCGTACATTATTGGGTGCGTTTATCGGCGCGTCAAGAAACCCCAGAACGGACGCATTTTACAAGTGCTGTGGATCG
ACAGTCAGTTTCAAAATGCCGTGCCAAATCTAGTGTGGCGGTTGTTCAATGGGGCATTGCAAACTACGACGCTCTCGGGCGCTCACCCAC