Description :
From Genome Similarity Track
Location :
Scaffold_152:58058- 59801
Transcript NameFunction/comments
Phypl_g4294hypothetical protein PHYSODRAFT_312945

Sequence
1743 bases(100 bases per row)
GCTCCTtgcgcacgcgctggagccAAGTGGCCGCCTTCTGGTAGGTACGGTTTAACGCGTAGGCTTCCTCGAAGCAAGTTGCAGCTAGCTCCAGCTGCTT
TTTACTGTAATGGCACAGCCCCATATTGTGACTCGTCACGTGGTGCTTGCCCATTTCCTGCGCGGACAGGGTGTAGTAAGCTAGCGCGCTGTCGTACTCG
TGCAAACCGTAGTAGAGTCGGCCAATTTCAAAAGCGACATCCTTCTCCTTGTCTAGTGCGTAGTAGTTTTTCCAAACCAGCGGGATTCCGTACATTACAT
CCTGCTTGAGTttggctgcagcagtcggtGACTGATCCAAGAGTACATCGCGGAATTTGTAAAACACGTCCGGATCCCACCCGCTCAGTTTCATCAAAGC
TAGCACAGCCTTGAGTGATGGTGCTTTGGCATCCTCCTTCGTGGATTTCTGCATCACGAAGAAGTCGTTGGGTCCAAACGACAAAATTTCATCGTCAAAC
GCCGTCGTAAGGTGCGGGAACTGAAGGCTACGCTTCTTGCACGTTTTGTCCAGTCCATCGCCATACAGCTCCATCATTGTTGAGCTAGGTGCTTCGCTTT
CGCCTGCCGCATTTGCCGGAAGCACGAAAGCAGACACCTTGAGACTAGCTTCTTCCTGTGGGCTATGTAATGCAAAGCCGCCGCGACTTGCAAAGTACAC
GCCAATAGCGTGGTAGTTAACCATGACGGAAAAGCTGCCGTGTACGGCGATGTGCGGGTCGCTGACACCTCGGAAATGGTCGGGATTGTTGTTTCCCTTG
TCGCCCGACAGTGTAACGAGTCCATTCTTCGACAGCGCTGCAAGGCGCTCAATGGCCGAAAGAGCTCCGATGGGCACCAGAATCGTAGCACCCGATGACG
CTGGGTCAAAGTACTCGTGGTACCACTTCAAGATGTTGTTGCAGTGCGGTTTTTCCTCTCCGTAGTACATTTCATCGATCTGCTCGTACTTGAAGGTGTT
GCTCAAGCGCTTGATGATCTCGGGGTCAAGCGGGTCAGGCTCCTCTGCACGCTTCGAGCCGACACTTACGAGCCCTTCCTTCAACACGCCACCGTCCACT
TGGAACAGGTCGTGATAAAGCGTGTCGAAGAGGTAGTTTGCAATCAAACACAGCGGGTTGACGAGCTCGCCGGGACGGATGACCTGACCAGACGAGTACa
ggcgcagctccgtgtcggtggtggcgtcAAAGATCGCAAAGTCCACGACCCCGCGCTTGACGAACGGTgccagcgctggatgcgTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTCAACGGGAAGTCCAGCACGCTCTGCAGTCGGCGAGCGAGACCGTTAGCACCCTGTCCA
CCTTaggaagaaaaaaaaacaggaAAACATGCATTGCGGAGAAGCTCACCTCCATTTGCGCGAGTGCCTTCAAGAAGTAGAAGCTGAATTTGCCCgatcc
agcgccgagctccacAATGTAAAAGGGCTGCGTGGGGTCCACGGGCGATGCCGCCCCGGGCTTGATGGCGTCCCGGAAGTAGCCGCTCAACACGTGGCTG
TAGCGCTTGGCGATGAAGGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGCT
TCCAGAGGTGGCAGCGCGCGAAGGGCGTGAAGCCCTCGAGCTG