Description :
From Genome Similarity Track
Location :
Scaffold_168:58050- 62098
Transcript NameFunction/comments
Physo_144134reverse transcriptase

Sequence
4048 bases(100 bases per row)
CCTTGGTTGAAATCGTAGAGCAGGGTACCACAGTTGAGCTTCGACACAGGCAGCCACTCTGCCTCATCGTACCCCTTCCACTTCACAAGGTACTCGCAAA
TCCGTCTCGCTGTCCGAGTCCGTTTAGTCCATCGCAAATCCAGGATTCTCTCGACTTCGTATTCATCGTTCGCAGCGTCGGGCTCCCAGCTGGCTTCAGG
CAACAGCGCCACATCAAAGTCATCATCCTCGTCCACGTCGATCTCCACAGTGGGCCGCTTCGGGGATAGTGCTCTGGGTTTCAAACGGCTCACGTGTACC
CAGCGGCTCACGCGATACCCTGTGTTCTCAACCCTGAGTTTCACGCGGAAGTTGTCATGGATTTCCTGAATTCTGAAGGGACCGTGCCACATGTGAGCCA
GTTTGCGGCTCAGCCCGGGCCGCACTTTGGGTATATACAGCCACACAGCATCCCCGGCTGGGAATCCTGCCTTCAGTCGTTCGGACAGCTCTCTCCACTT
CCTGGTTTGTTCGGCAGAGCGCGCCCGCTTGGCCTTCTTCTGAAGATCCTCAGCGCAAGCTTGTGCATAACTGTAGTCACGCTGCAGCTTCCTGTGCCAC
TCGTGCGCTCCTGGATACTCGAGGGCCTGGCTCCCAACATTGCAGACCAGACATAGTTCCGTGTGCGTCCCAGCCGTGCACCAGAAAAAACGGAGTGTCC
AGGCGAGTGGCATCGAACAATGTATTCAGGGCAAACATCAAGCGCTCAGCATGGTCGTCCCAGTCGCTCTGGTCCGCCTCAGCAATGTACGCTCGAATGC
TGCGCACGACAGTCTGCACCGACCGCTCCTGTTGTCCGTTCGCCTGGGGGCGATACGCCAGAGTGGCCCGCTGCTTGCTACCCAAAAGTTCACGGAAGCG
CGTGAACACCTCGCTTATGAACCTTGGGTCTTGGTCGTGCCTCAGCATCGAGCTCGTGCCGAATCTCCTGAAGACTTGCTCTTCGTACACTTCGGCGACA
TCTTGAGCTGTGGTGGAACTCATGGGTTTACACATGACGAATCCTGAGAACGCATCCTGAAAAAGCAACAGGAACGTGTTCCCACGATCCGACTTAGGCA
AATGCGTCACGAAATCCATGGACACAACTTCAAAAGGGCGCCTCGGTTCGATGTTCCCAGGGGAGGGCCCTGGATTCTGAGGGTGCCCCGCAATCCACAC
ACTCTTTGACGAAAACTTCCACGTCAGCGTACATCCCATGCCAGTAGAACTCAGAGCGCAGTTTCTCGTACGTCCTCGTGATCCCCTGGTGCCCACCCTG
AAAATCTTCGTGAGCGTAATGCAGGATATCCGGTCGCAGAGCTTTCGGCACCACGAGTCTTAGTTCGTCAACCATGTCTCGGGGTCGATCTCTGGTAGAC
CGACTCAAGCGGTACAGGACTTCTCTGGAATCCAACGCGAAATCGTCAGCGACCTTCGCGAGTTTCCTGGCTTGAGCGTGCGACAGCTTCGTCGTGTCGC
CCTTCAGGAAATCCTTGAGTTGCAGCAGGTGATCATCTTTGTCCTGGTGCACTTTGATGCGTCGCCAGCGTTCTGCCTGGTACTCCAGAGGTCCCATGGG
TTCGCTTTGGGCTTCGATCTCCTGAGTTCGCGCCCGAGTCATTACTGCAAACACTTTGCCCGCCACAGGCAACGGAGCGCACTCAGGTCCAGGGATACCC
AGAGTTTCGACACCCTGAGAATTACTCCCCCGGATTCCAGCGTTCAATAACACCTTCGGTTTTACCAACTTCTCGTGAATCTTGGACACCAACTGCAGAT
GTGTTCGTTCGTCAGCATCCTCCACCTTCCAGGATTCACCAAGCGCGAGGGTCTTAGACGTCAGGTAGTCTGCGGCCTGGTTAAACTCTCGCTTGACATG
CACCAGCCGCACAGACTTGAACTTCGTCTTCAGTACTTCATACTCGGCTAGCTTCCTCTGGAGATTTGGCTGATTGCAGTTGAAGAGTCCCTGGGCTTGC
TGGATGGCAATCCAGGAGTCCCCAACCACAACGATATCCTGAATTCCACGCTCAATCGCCAGAATGAGGCCCTTCAGAAGTCCATGATACTCAGCGTCGT
TCACAGTCACGTCCTCCAGGATGAATCCCTGGGCATCCAGGATTTCCCACCCGAGGACATGCCATAGAATGCAGCCGCAGCTCCCTTGTCGCGTGGAAGT
CTTAGCGGCGCCATCGAAACTCAGAATACACCCCTCATAGTCCGCTTCCAGCATTTCCATACTGATAGGCACTGGAGGTTTAACGCGCCCCTTGGCAGGG
ATCAGGTTTTCAGCGATCTCATCCAACTGTTCTCTGGGGGTAATACCCGCACCTAGAATTGCAGCCAAGCCGTCTTCATCCCGTTGAACTCTGCGTATCT
CCAGGTTCTAGTGGGACAATATCAGACCCCACTTCACCGTTCGACCGTCTGCCGACTACGAGGTCAGTAACCACTTCAACACAGAATATCGCGTGTAGAC
GACGATCTTAGGTCTGCCTTCAACCAAAGTGCGAAACACCTCTAGGACTCTCAGGATAGCAATCACCTCCTATTCCGCAATGTGATACCGCAGCTCAGTG
TCATTCAGGAAGTGATCTGTGAATCGAACCGGGTGCACAATCCCGTCGTACTCCTGGCCCAACACAGCGGATGGTGCCCACGGGTTCGCGTGGGGAATAA
TCACGAAGGGCCTTGAACGATCAGGATGTCTGAGTAACGGAGTCGAAACAATCTTGTGCTTCAGGATTTCAAAGGCTTCCTGGGCTCTCGACAGGTCTCT
CCTGAATTTCACTTGTTCCTCAGTCAGCTCGTACAGGACGGCCGCGATCACGGGTAGATCTTCAATGAACTTGTTGTAGTAATTCAGACTCCCCATGAAA
CTCTGGACACCTTTCAGTGTTGTCGGGAACGGCAAGTCTTGGACCCCCTTCGCGATTTTAGGGGTCGCTCGGATGCCCTCAGCACTAATCTCGTAAGAGA
GGTACGGAATGGACAACTTCCCGAATTCGCTCTTGGGAAGTCTCACAGAGATATTCCAGTAACGTAGTCGGAAGAGCAGCGCGTTCAGATCCTGGCACAG
CTGCTCCCAAGTAGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAGGACAGGGCCCATCTGATAGGGAGCCGGGATGTTACGCTGAAAA
ACAGTCATCTCATCCGTCAACACTGAAAGTCGCGGTGCATTTTCACCTGAAACTCTGGGTTCCCCAGCGTTCAACCCCAAAAAGTCCAAGACATCTTGGT
CGACCTCAGCTTCTTCCTCAGGGGAAAGCCGCAGAAATCCCCACAGACAGTTATTGAGAACTGCCTGGTAGATCAGCGGCGCGTTCTTGAGGCCAAACGG
CATCCTGACCCACTGGTAGTGCCCATAGGGACAGACGAACGCAGATATCAACTTGGCTCTCTCGGTCATCTTGATAGCCCAGAAACCACTCGCCATGTCC
AAGCCCATAAACCACATCGCCGACTCAAAGCCAATCAAAAGATCATCAATAAGCGGCAGCGGATAGTGTGAGAGCTTGATGAAGCCATTCACCACGCGAT
AGTCGATGCACATCTGGATGTCGACGCCATTCTTCTTGAGGACGATCACGATTGGAGATGCCCAGGGGGACGTAGAAGTCTCGATCAGCCCGTTCTCCAG
AAGCTTCTTCAGAAGTTCATACACCTTGGTCCACAGGTGTGGGTCAATGGACCTTGGACGCTGAGCAACAGGTTTAGCGTCGCCTACATCCAGGTCACAA
ACCGCTCCACGGGCAGGTGGGGGAGCTGCATTGCCGTCTCCCAAGATGATCTTCCGATGGTATTTCAGAATTCGCCTCACTTGGTCTTCCATCTCGGGCG
TCGTTTTCCCAGCGACTCCAACATCTGCCTCCTCGATCTTGCACTCAGGAGTCAAGTCACGCATCTCAGGAAGCATAACCAACTGGTCGCGCAACTGAGA
GAGTAACTCACTTCCTTCGCGTATGTAGACCGCGGGCTCGTAGTCGAG