Description :
From Genome Similarity Track
Location :
Scaffold_961:5804- 7322
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_961-fgenesh-gene-0.2U3 small nucleolar RNA-associated protein

Sequence
1518 bases(100 bases per row)
GTAGTACTAAGAGAAGATGTCGCTGCGCAACGTCGTCAAGCGCCGCGAGCACAAGGAGCGTGGGCAGCTGCTCGAGCGCAAGAAGCTCGGGCTGCTGGAG
AAGCATAAGGACTATGTCAAGCGCGCGCGCGACTACAACAAGAAACAGGATCGGCTCAAGACCATGCAGGTCAAGGCGTCGTTCCGCAACCCGGACGAGT
TCTACTTCCGCATGAACAGCACGCGCACGGAGGAGGGCGTGCACGTGTCGGAGAACAACCACCACGGCAACAAGGCCGTGAGCGCCGAGGCGCTCAAGGT
GCTCAAGACCCAGGACCTCGCGTACCTGCACATGAAGCGCGCCGTGGACCTGCGCAAGGCCGAGAAGCTCAACGCCGGACTGCACTTCATCGACGCGCCC
AAGGGCAACAAGCACGTGCTCTTCCTCGACTCGCAGGAGCAGGTCGAGTCCTTCGACGTTGCCACGCACTTTGACACGGCGCCCGAGCTCGCGGACCGCG
CGTACAACCGCCTGCGCACGGCGACGCTAAAGACCGCGGTCCTGCCCAACGTGAGCAACACTGCGGCCGTCAAGCGGCTCAATAAGGTGCGCGACGGCGT
CTACCGCGAGCTCAACGACCGGCTGCAGCGCGCCGCCAAGCTCGACCGCATGCGCGCCAAGCTCGACCTCGAGCGCAAGGTGCAGGGCAAGGGCAACAAG
CGGAAGGTCAAGGACGCCGAGAACGGCCTTCCGGCCGTCTACCGCTGGAAGAAGCAGCGCCAGACATAAGCGATTTGATTTTATAACAACAAACAACAGT
AAACACGGTGCACACTTTCTTACGTGAACGATATCGTACCAAGAGGCTCTGTATCCGGTGGCTCAAAGCTTTGTGCGTTGGCTTTTGTTGGCTAGTACAC
CAGTGCGAGGAGGCTCCACGACTGAGTTCGACTGGAGGTAGTGGTGATGTCCATAGGCCTGGCATTTGAGACACAGAGGTGCTGTGAATATCCGACAGTG
TGGCTTGGTGTGGAGTGTATGGACGCACCTTTCGGATCTGGCGCAGGAGCTCCAAGATGACGCGTCTGTCGCCGTTGTAGATCTCGTGCTTGCGCCGCAG
GAGGTGCAGCGGCATCGTCTGCTCACGACACACAGCATGATGCAGACATAAATGAGCTTGGCAGGCAGGTACAAGTAGAAATTGTGGATAGACAAACGCA
CTTTTCGCTGCTGCAGGATCTCGAGCGCCTTGGAAATGTTGTGGAGCGCGTTCGCTTTCGTCAAGTTGGCCTTCCTGCACACGCCCTGGATACAGCGCAT
GTACTCGACTCTCTCCACAACGGAGCAAAGCAGCACGCCCGACTGGAACTCCATGAGACGAGCAGAAGGGGTCTGCTCAACAGAGTTTGAAATTCGTGAA
TCACAATGTCTCTGGGCTCTTTCATGCAAGTGGTTGATTCACTCACCTGGAAAGCCGCTGGGTCTGATATCCGGATCTTCAGCCGCTTAAGCCACGCAAG
GAGCTCATGGATCGACTC