Description :
From Genome Similarity Track
Location :
Scaffold_6:58029- 59503
Transcript NameFunction/comments
Phyra_74033Hypothetical protein

Sequence
1474 bases(100 bases per row)
GAATTTGTACGAGAAGTAGCCATTTAGGTGTGCCATGCTTTCGCAGTCCTGCTCGGTCTGGATCCTTTCTAGTGTTTAAGTCAAAGGCTTTATGTAGTTG
CTGCCGACAGCATTCGTTGGCGCCTTCCCGTTGAATCTAGCAGCGGTCACCAATACGTTTTAATCAGCATAATATGCCGATAATCGCGCACGAAGAGCTT
CTTCAAGAAGAAGGGTTACAGCTCCAATTAACGAAGTCGAAGCGACCTTGACGAAAGCCGGGGTACACTGTCCACAAGATTCAAACAGGTGTAAGGCGAA
CCTTGAGCCGGGGAAATTCACTAGCTCTCGGACTCTTTTGGGATTTGCTTTTTTCGGGCGAGGCAGATGTTGGTCAGCCATACCGGTAGATGTATTAATA
CATATATCATACTGTACTTCGAAGTACAATACATGTGCACTATTGTTTTAAGAGGAAAAGTGAAATGCGTTACCATGGTTGACTCCAGCCAGCAACACAA
AGCCTTGTGTGCTTCACATTAGTGCGTCGGTTATGGCGCTAATCATAAGAACTAAATGAGGTTTGCTCCACACTCACTGTGAAATTCCAGTGCAATGAAT
CTCGCCACGCCACCAAAACTGGGACCGTGGGGATCTTTGCGATTTGCACCGCCGCGTCGCTATTATACCTGCCGAATTACTCAACGGAGGTTGAAGGCCG
TGACGACACGACCTGCACATGAATAATTGGTCGCTGCAACAGAGCACACCACATCTACGTGACAGAGGTTGGCAGTCTCATTATTCAATTTCCAGCCTTT
GCCCCAGTTGGGTCGCTTCCGCTTCGTCATCAACACAAAAGTCTGTTTTCATTGTGAAGTGCTGACTGTGGGATGAACACCTTGAGCGCATTCTACGGAG
TGCTCTCAGTGCTCGTCACGGCGACTGCCGCCGCACCGGAATTCGGATTCGGCGATATCATTGGCATCTTCACGTCGGCTCCATCTGCAACAGCATCTAT
CTCAGGGTCTACAATGGACACAACGCAAGCACAAAACCTCGAGTATTCAGCACCAGCAGACAGCTCAAATGCTTCGGCGTCCACAGTGCAGACAAGTTCG
TCCACGCTTGGCACATCGGCGTCTGCGGCACAGACAAGCTCCACAACGACGCAGTCAAACGTTTCTGGCGCGTCGAGATCCACGGATGCGACGTTTACAA
TCGGCTCGGCGACAAGTGCCGTCAGCACGATCGAGTCGACATACAACAACTGGGTTGGCCCCGTCGCCACCCCTTCCGACACAGCATGCTATCGTGAAGC
CCATGTCGCCGACACTTGCCCATTGGGGTTTAACAGCCAAGTTGCATCGTGCTGGGCTCAATGTGGAATTTCCTACCCTGTCGAGTGTGGGATGGAATGC
ATTCGTCAGAATGACGACTGCAAGCTCGAGGTCGTAACCAAAGTCTCCGTTGTATTCCAGTCAGCAATGTCTCT