Description :
From Genome Similarity Track
Location :
Scaffold_6:58018- 59114
Sequence
1096 bases(100 bases per row)
AGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGACGGAAGCCGTTCAAGTAGAACGGCGTGAACCCC
GTGGACGCATGCACCGCGTCGTTGAGCGCAAACTCAGCAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCT
CGAGCACTCGATAGACGCGCTCTGTCTGGCCGTCTGTCTGCGGATGGTCCGCAGTAGACATCTGCAGACGAGCTCCCAGTAAAGAGAACAGCGTTTTCCA
GAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCATCTCTGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGATTTGTTCG
CCCGTAACAGTGACGGGAACCGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGTCGTGTCCGTCGGCGGGAAGCC
CAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACAGGCAGGCTCTGGAGTGGAGCCGAGGAGTGCTCTGCGGGTTTGACCCGCTGACA
TGTTTCCCATGTCTTAACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACGGAAAGGTCTTGTCGCGGCCAAAGTGG
CCGCTGGAGGCCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACTCGTGGAGGTTCATTGGGCTCCTCCCGGT
AATAGAGGAGGCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGTCTTCGCGCTCGTTCCTGCCATAAGGAACTT
GACAATAGGCGCGACAGCCTCATCGTTCCGATACGCCATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACACATAGTCAGGA
CGCCGGGAGAGGACGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATC