Description :
From Genome Similarity Track
Location :
Scaffold_558:5801- 8359
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_558-fgenesh-gene-0.1Kinesin K39,
Pytiw_DAOMBR242034maker-piw_contig_558-fgenesh-gene-0.2P-type ATPase (P-ATPase) Superfamily

Sequence
2558 bases(100 bases per row)
GAGGAAGAGCCGTCCAAAGTCGTCCAGAACAAAGAGCGACATGCAGTGCACGACGCGGACTTTCTTGCTCTTCTCAACGTAGCTGTAGTTGCACCAGAAA
ACCACTTGTTCAGCACTGATCCAACTATGTCGAACACGAGCTAATAAAGGCGAGTTTGGTACCTGACGTAGAGCTGCACGAGGTCGTTCACCTGCGCGTT
CATCTTTGCGTCCATGCTCGCGATCCTCTGGCTGCCGAGTGCGAGGCGGAAGAGCTTGCACTGCGGTCGTCCAGACTTGTGGAGCCTAACGGATAATTCG
GAGGCATGTCACGAGTAGCTCTCAATGCAGATAGCCTGAAAGTGCATGAAAGCTTTCTAAGGACGTACGTGAACTCGTGCTCCATGTTGGCGTACTTGAG
CGGGTCGAGGTCCCCGCCGCGTGGCGCGACGAAGGCGCTGAGGCACGCGCTGCCATCGCTGGTCGCGAGTGAGTTGAGAAACGTGAGCATTTCGTGCGCG
CTGAAGAACTGTATCGTGCGGATCTGGTCGCCGAACCAGCACACAGCGGCGTACTGACGTGCGAGATCTCCATTGCCATTGCTACTGGCTGCTGAACCGC
GTGCGTTCGTTGCAAACTCGGCGTGCACGGCGTCGATGCTGAGCTTGGCGCGCGGCTTCTTGCGGATGATGCCGCCCGAGGTGGAATAGAACCACGACCA
GATCTGCTGCTTCTCGACGAAGACCGTGTCCAGGATGCTCACCACGCACTGGTCACCAACACGAGAGTCACAACTTTGTTAGACGAGTGAGTATACGAGA
AGTCATAGCTTTAGAGAGTCTCTTGGCTCACCTCGCCCTTATCCTTGTTGACGAGTGCGCCGCAGACCCACTCCCAACAGCGCCGCGTGCGCGGCTCCGC
GGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCGCCGGTACGG
ACGCGCGGAAGAGCTGTTGCTGCTGCATTGCCTTTGCTATTGTGTCAAGTTTGCGATGGTCTCTTCGAACTGTGTGGTCATCGTCAGAAGGTAGGCAGCC
TGCATTTAGAATGGCTGGTTGAAACGACAACCTGCAAGTTGAAATCAGTGCACCACCCATGGATCAGTTCCACTTCACCTCATCATCATGCGCTTGAAGT
TTAACAGCTCGGGGGGTCTCTTCTCCTATTGATTCGGGTGTGTTAATACTAGTATATAAGGGAGGGGCACAACGCCCAGGTAGTAGTTGGCAGCATATAT
CTTGGCAACCCACTTACCTCAGCGCTGCTGCGTGGACGTGGTCGAGTGCTTGGTGGACGGCACCGATTCGTCCGCAGTCGATGATGAGGATGGCGACTGC
GACGGATGGAACTGCGGCCGCTGCGACAGGTTGTTGCTGGTGGCGCTCGTGCGGAACGTGCTCATGGCCATCTCGCTCTCGCCGGGGAAGTGCGAGAACG
CAAAGCCCGTATTGCGGCGCACGAGCCGCGGCGACTCCAGCACGACCGCCGCGTCCTCGCCCTTAGCCAGGCGGTTCCACTCGCGCATCAGGTGCGACGG
CTCGGGGTAGAAGAGCACGCGGCCCGCCTTGGCGATGAAGTTGGGCAGCACCGCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCATCATGAGGCCGAACCAGAACCACGCAGCCGCAAACAATTCGCCGAAGACGC
CGTAGCCGTTCTCCGTCTCGTAGAACTCGGTCTTGGTCCAGCCGTAGAGCGTGCAGAAGAACGCCATGAAGAGATAGTAGAACACGAGCGTGCCGATCGT
CGAGTAGATGTTGGCCTTGGTCCAGTTGCTCGTCATGAGCGCCACCTGCACCGTCGACGCCGTGATCAAGTACGTGTATGCGGCCACGCCGTCCGCCCAA
AGTCCCAAATCGCGCGAGCCGAAAAGGTACTCGTTCGTCGAGTCCTTGGCAAAGTACCACACGATGAAGCCGTTCGAGAAGAACGGCACGGCGTAAATCA
CGTACGCGTGCCACATACCGAGGCCGCACCAGCCGAAGAACGTGATCCAGTTAAACGACCGGTTCTTGAGCCCGTTCACGTACAGCGTCGGGTACTGCAT
GAGCACGGCGGGCGACACGTCCTGGTTGTACATGGCGATGAACACAATCGGGATCGTCGTGAAGAGCGCGTTGTAGAGCGTGAAGCAGATGCCAAAGTAC
ATGAGCAAGCCGCTGTACATCGTTTGCATCGCCAGGAAGAAGTTGGACATCGACAGCG