Description :
From Genome Similarity Track
Location :
Scaffold_257:5801- 6982
Sequence
1181 bases(100 bases per row)
TGTTGATGCATGTATCCTTGTGCGGTAATGGTGGCCAGCCGTGTAAGACCACCGTTCATTACGAACTGCGTGACGGTATCTCTCACGACACTAACTCGTG
CATGCGCTCGACTTGACACTGGTAATTAAACTGTTGCAAGATTGCAATATGTCGAAACTACAGTTAAGCTCTTAAGGTGTTGAGGACGCTGCAAGGACCA
CCATCATTTATCCATACTATTTTTCTGTAGGGTTATAAAATTCGAAAAAGCGTTTGAGTCGTTTGATTTTCATGCTTCTCGTAGTTTGTAATTATTCTCC
TAACATGTCAACCATAATTTTGCTCCTTTCCTTCTCTATATAAGCTTAAAGCGTGGAAGTGGACAAGTTACCGCATTCGGAGTCTAGAATATTAGTGAAC
ATTGATGGGTGGAACGGCCTTCTGAATTATCATGTCACCTTGAAGGCCTTGCTTGAAGTAGCTCATCGCAGCGATAAGGTAGTCACTAATATTTTTTCCC
GAGGGCGATGCGCTCACCGGACAGGTATCTTACCGAAACCTTGCTGAACGCAACACATCAAATTCATAACCAGCAGCTCATAGATTTACAAGGGAGTTAT
ATAATCACATCCTTTTTATTCAAACTTACACCTTTGTCAAACCTGATATCCACACCCTGCCTGTTAAACCTGATAATTGCACCCTTTTGCCAACCCCAGT
TGTTATACCCCTTATCCACATACTGGTACTCTACGTACAACAACCGGATGTTTATATACTATTTTCCGTACCTTTGTTTCACACACTCCACCGATTTTGT
ATTTCTCTTGACAGGAGTCACCTTTCAGGGCCATATGGAATGGATTTTGTAATTTAAGCTTTTATACAATATACAGAACTATTCAAGAGTGAATAACTTG
CCTGTTTGTGTAATATTGAAAGGGATGGTCATCAGTAGGTAAAAATAACGATGTCATCGCTATGAAGTCTGCTTATTAATGGTACATACCATATACAATT
CTTTCACATTTTTAAGCCTCTATACCATAAGAATAGACCTATTCCATAACCACACACTGTTATGGATACTTTCCTCGACCTCATGAAATTTCCGTCCGGT
ACTCCTCCGTACCGCCCACAGTCGGTCTGGAAAAAAAATATAAAAATATCTGAAATTTAATATTCGGAGGCAAAAAGTAGC