Description :
From Genome Similarity Track
Location :
Scaffold_221:58009- 63623
Transcript NameFunction/comments
g14878.t1ETL36420.1 hypothetical protein L916_11592 [Phytophthora parasitica

Sequence
5614 bases(100 bases per row)
ATTGCGAAGTAGATAATCGACCCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATACGAG
TCTTAATCGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTTCCCTTGGAGTTCTCAAGCATGTACAGAAT
CTTGTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACG
TCCACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTGATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCT
TTGTGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAG
CACGGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTT
TGCGATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTGTACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGC
GCCCCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCG
CTGGAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCA
AGGTACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCT
CGCCCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAG
TGTTCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCC
TTAAGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATAC
TGCTCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTT
GTCCAGAAACTTCATATCGTTAAGCAGCTTTTTGGCCTCATTCCACTCTTGCTTTGAGCCGAATAGAAGGCACACAGCGTTCATTGTGACACCCACAAGT
CTCGGGGGATTGGTGAACGTCTTCAACACCGTAATATCATCCTTTTTCAACTGTGACAGCGCTTTGATTGACGCGTAATATGCGGGCATAGCTTCATCCA
AGTCCTTCTGACAGTCGTCCTTGATCACCTTCACTTCGTCAGCAATCTTGTTAGCAGCCTCGACATCAGCCTGAATTAGTTGTTGCTGTTTGTCAGCTTC
TGCCTGATCCTTTGACACCTGTTCAAGCAGCAGCGATGTGTCCTTTTGAGCTTTGACTAATACCGGCTGCAACTCAGTAAGTGAGCTCTTCAAGTTGCCT
ACGACTTCCTCGGTCTCCGTAAGCTTCTGCAAGCCACCGCGGTAACGTGCTTCCTTCGCACGTACGAGCTGGCGATGTGTACGCAGCATATCCACGTACA
GTCGAATCAGCTCCAAGTAACTCGTAGGAGTGGTGTAGTTACGACGCTTTAGCTGGGCGTAAAACCGAAGAGTAGCTTCTTCAACACTGCGGTGAATTGT
CACGGCCATGCGGCACAATGTGTCCACATGTGTGTCAATACCAAGCTCCTCAGCGTTCGTAGCGAAGAAGCGGTTCGCCACTGAGTTAAGAGCGTCTTCT
GGCCATGCATTGAACCAGTCGATGGTACAGCAATTCACGAGAGACGGAAACATGCGGCAGCGGTTCCGGAAGCCAGCGCCGATAGGAGAAAATGCCAATA
CCACATGCAAATTATCACGAACAAGAGTCACGTAGTACTGGAGAATATCTTCGCGTGTAACTTTGCCCACCTGCTGAGCCAATGGACGAACGAGACCCAC
AATTTTCTCCACTTCGTCGCTCGCATAAAGATTCGGCACTTCACCAGTATTAAGGACGTTGTTAATGTCTTCAAGAAAGGATTCATGAACGATTTGAGCA
TCCGAAAACAGGAAAACGACAGGCTGGTTCTGAGCGCCTGCAGTCATAAGGATCTTCTTGAGGTCTTCGTGAAATTCATTGGCGCCATATCCACGAGTAA
TTTCGATCGAGAAACACTTGTAATCCGCCATGAATGCAGCAAGACGTGTAAGACTCTGACGACCTGAGCCACCAACTCCAACGAGTAGAGCATTACCGCG
AGGCTGTCGCAAAACACGGCAAATGCGCGAGATATGGTGCATGGCATCGTTGAAAAACACCAAGTGCATCTGACTCGGGAACGTGATGTTGTACTCTTCG
AGATACTCTGACAGCAGTGAATTGAGCTGTCCGAGATCTTCAATCGGTCGGTACGTACGGTTTTCGCGCGTAAGGTAATCGCCATACAAAATATTCTCGA
AGCGCGCGGGAGGCCACGAAACTCGGAGCCTCTCCTCGAGTAGTTGCGAACAAGCCACATTAAACCAATCTCGATCATCAGCGTCTACCAGACGATCACG
GAAAACTCGTGCTTCTTCATGCAGCCAAAGTGTTAGCAGGCCATCTTCGTTCGGTACATTCTCCTTTTTCGCCATCAGCACACCCTGGAATACTTTGGAA
AGATCACGAAGATTGAACGTGTAATGTGACTTCGATGGTGTAGGTAGCATCTCGAGCTCCACGCGCTGGTACAGCTGCACCGAAGCGCTCACAATAGGTG
CTGCCATGTGTGTCATTGCAGGCAACTCTGCACCGAGGAAACCGCCGAGGATTGATGAGAAGATCCGCTGCATAACCTCACCAGAGAGATTGGGGATCCA
AACCATGTGGAAATGACGCATCAGACGCGGGGTCACTTCACTGCGACCACCTCCAGGAGGAGCACATGCGGCGGCAAACACCACATCCTTCACATTTTTA
AAGAACATTTTGGATGTGTCGTAGAAACCACCTTGGTCGATAACTTGCCGCAACAACTCGTTAGGAGGCTGCGCGCCATAGATTTCGAGCGCCGGCATAT
TCAAATCATCCACAAAGAATAGCATGCGCTTTCCAACAGGTGGACCCAGCAAGTTCTTTCGCTTTTTGTCCAGCTTTAGCTCGAACATCTCGTTTAGGTT
GCGAGGCTTGGTTTGCGCCGAGTAACTCATGGTAGATGCAATGCAGCTATCTGTCTTAGCCATATCATCCAAGAACGACTGGACAATAACAGATTTGCCA
ACACCAGTCTCGCCACTATACAGCACGTGATGATCTGAAAGCATGAGCTTCTCCAAGAGATACCGAAAGCGCGTCGTGTCTTGCGTGGGCACCACCATCG
TGAAATACGACGCTCCGGGGACAAACGTGAAAGTCGGGGTCTTATCGATCCACGAGGCCCACTGGCCAGTTGAATCATCTACTACCACTTCGTACACATT
AGTCACGGGTGTGCCGTCAGGACTGCTGTCGATCAGTGAACGGAATTGGCCCATGGAGAAGTCATTGAATTTTGGACGCGATGCGTCGTCGATGTTTGCT
CCGACAGACCACGTAACAGCAAATACAAAATACATGCGCATAAGTCCCGCTAAATTGCTAGCACCAGCGGTTTGCACAGCACCGCTAGCGAGACAGGATG
CCAGGAGATTGAGACAGCTCTGCATCAGGTTAGCATTGTTGCTGGGCACCTTTTCTCGGCAGTTTTCGCGGACAAAATCAATCGCCACAGGAACATGAGT
CTCAATCAACAAGAGAAGCATATCGCACAGCTCTGGATAGGCCGATAGAATCGGTTCCAACGTCGTCACTTTCCAGGTTCGCGCCAAGGATGTCAATCCT
ACGTGCACTTGCTCCATATACACCATGCCACAACGGCTGACAGTAGCCGGCGAGGCTACACGGAGATCCTGTACCTCAAACATCATGTGAAGTGTGTGGG
GCAGTTTGATTCGCTCACTGTTCGATAAGCACAATGTCTTGTTGTCGTCCAACACCGTATTCATGTTCTCAATCCAAACAGCATCCACGGGTCCGTCAAA
AATGACCCAGTTGCGGTTGTCAGACTCAGCGGCTTCCTGTACACACTGTCGAACCAACTTCGGTACTAGTCCATCAGTCCACTCGTTCGTTAGGAGATTG
AACTCACCATACAGCTGTCCTGCGGAGATAGATTTCGGGTTGAGGATGAGACGCTGGACCTCTTTGTAAAACCCATCGCGGTCAACAACACCATCTTGGT
AGAGTTGAGTCAGCGCTCTCGCCAGCACGTATCCATTCGTGGTCTTTCCACTACCAGCTTCACCGACAAGCATCATACCGTGACGGACCAACTGCGTCTC
GTGAACCTGAATCGCCTTCGTGATAAATGATGGCACTTGTTGCAAGTGAAGCAGGTCCAACTGTTGCTCAATGGCTTTCTGGAGTAGCCCATAGTCGACA
AAAGGCACCACAACGCCTGGGAAGAGGTCTGCAATAATTCCGCGAAACAATGGGAGATCCTGCTCAAGGAACTTAGGTACATTACTGTCTCGCATAGCTC
GGATGAGAAGCAGATCCTCGTGCATTTCGGGTTCCTTGCGTTTTAACTGGCCAGCAGCAACCAACACAGACTTGACGGCTCGCATACCGAAATCGTAGTG
ATCTTGCTTTGACAATTGCTCACTGGAGAGCGAGTAAAGCTGAGTCATCTTATGCGACAGCGGCAAAGCATTCGCAAACCCCTCCGAGAAAAGCACGATC
TCGGCAATTAAACGGTAGTCCGGCACCATCATAGCAACGGGGCGGAAAAGTGCCTTCAAGTTATCTGGAAGCTCCGTACGTCCAGCATAACCCGGATTCA
TTGTAATGAAAACGCCAAAACCTGTGTTGAGTCTAATGAGATTGCCTTCAAACTCAAACTCGTCCACGTCAGCTACAATGGCCTGCTGAATGCAAAGTAC
CTGCTGAGCAATCACAGACAAAACTTCGATATCAATGCGGTTGAACTCGTCGAAGCATGCCCATGCACCAGCCTGAGCGAGGCCAGAGAAAAATCGTCCC
ATAATCTTGTAATCCAGTCCATCCGAGCAGTTGAAGACGACACACTGCACTGCAAGCGCTTTAGCCAAATCTTTCGTGGTTTCTGTTTTGCCTGTACCGG
CTGGTCCAGCAGGAGCGCCACCTAAACGTAGATGCAGTGCACCCGTGAGTGTCATGTAGCAAATGTCCGTCAGGGGCGTGATCACAAGTCTCGGTGAATT
GCCAAGATATTCAT