Description :
From Genome Similarity Track
Location :
Scaffold_96:5800- 10819
Transcript NameFunction/comments
Phyta_totarag3477hypothetical protein PHYSODRAFT_326804
Phyta_totarag3478hypothetical protein PHYSODRAFT_487310

Sequence
5019 bases(100 bases per row)
GCACATGgagtccagcaccacgtcgccatacttgtgctgcacaagctgtAGCATGAGGTACGCCGTGCTGGGACGCAACGTGGAAACGTACTGTGAATCC
GCCAGCGCACTGCGACTTTCATTCGCCAATCGGTTGCGGAACTGAATCTTGCGCGGATCAGCCAGCGCGATGCCAGACACCATGAACTTGTAGAAGATAA
CCACGACCACCTCCAGATCGAACTCCGTCAAGTTCACACCCCACCCGAACTTCTCAATCACACGCGCACCGACTTCTCCCGCCACTGTCTGCGAGTTATA
CGTGTGCTTGCCATCACGCACACAGGACCCTCGGAACTTGATTCCACCGTCCCCCACCGGACGCACCGCGTGCTCTTTCCACAACTTCACGGCCGAGTCC
CAATCAGACTTCATCAGCAATTGCTACACGACATTGAACCAACCAACCAACCGTAAGTCCAAACATCGCACCACCTCATTGCATTATCAGCTAGCCAGTC
ACTCACCCCAATCTGCTTCACACCTGCGTCGCTCTCCGTGTCAATCTCGTCgctcttggccagcagcgccagcatcgccTGCACCGAGCGCAACTCCTGA
ACTTCAGCAGCCGACGACTTGGTCTGCAAAATGATCGTTCCAACTGCAGCTTGACCCTGTAGCACCTGCATATAGGGCGGACGAGGGTTCTCCTGCACGC
TGCATATCTCCAAACTCTCCACCTGCAACTTGGAGCGGATTTCTTCCTCCGCCAGGAACTCCAGCCcacgcagcaccagcagcaaatacGTCGAGATGTC
TTCCATTATTGAGGTGTCAACCACTGCTTTTAGTGTCAAAGGTTGTGGTTAGACcatacaaaacccaagtGAACAGCAGTTACAAATATTTGAGTACTAA
AAGAAATATCTGATACCTCAAAAAGTTCGGACGAGATCAAGTTTATTCTGTAATAGGTACCGGTAGACGACCCCATGGATCCGTCCAAGCTGCCGCTGTT
CGCTCGAGGACGGAGTATGTTGAGTGAGGCGTTGTCTCCGACCACTAGACGCAGATTTGCTGGCTTTCTGGAGCCCGGGACCCCGTCGGAAGAGTCTCAA
AGTCAGTTTCCATTCGCCTTTTCCCAGTCTTCAAGCCCTGCGCAGCGGCAGAACTCGTCGCCTGTGAGACGCACCCCATCAATACGACGTCGGTCGGCGC
TGTCGGAGGCAGATTTTGACGGAAACAACACAAAGGACAAGAGTTTGGTGCGGATTCAGTGCAATTCGCGGCCTTTTCGGGTGCAATTGGCCTTGGAGAG
GGGTCAAGTGGTGGTGCACGGGTTCGAACGCAGCGTTGACAAGGGGAAGAGAGGACCACCAGAAGATGTGGAAAGATCAGGACTCGTGCAAGTTGGTGAC
GTGTTGGTGGGTGTTAATGGGGAAACGAAGGGGTTTTCGACTCTGGAGATGGCTCAGACGATGTTGGAGAACGTCGAGCTGCCGGCTCTGCTGACGTTCC
GACGGGTGCTGGTGTTCAAGGCAGCACTAGGGGATTACACCGACAAGCACATTGCTCGGTATTTGGTGTTGCAAGATAGTTTGTTGGCCAGTGTACGTGG
CGTACAGGAAGCGACATTGCTGGTCCAAGCGTGCATTGAAGTGTTTGGTGAAAGTAAGTCGACGGTGCCGTTAGAAGACTACATTGACCATGTTGAGCAA
GTGGTGCTACCATCGCTAGGTATTTTGTCGGATGATATGATGAGCGACAAGAAGCACCAGCTTGAACAGATCAAACAAGTTATGGAGACGGTGCATCAGC
GCGTGGACGCTCGGAGAAAGAAGCAAGTTAAGGCGTGGAATTCAGCCAAGAGCTCTAATTACCGACGAATTGAGATCTTGTCTAGACAACGTACTAGCAT
CAAGGAAAAGCTTGAGAAGATGCGCGAGGACCCGAAGGAACTACGGCCGGAGAACCACACAGTATGGTCCGAGTATATCGAGCTGCGCCACTTATTCACG
CAACTGAGCGAGAACGTGGAGAAGTCGAAACAAGAGCACTACCTGCCGGACTTTGAAGGATATTCGCTGCGCTTCGGAAGTGACGGCATCTACGTTGGCG
TCGGAGATATCTGGATTCCATCATTTCACGCCAAGTTCTCAATTGAGACAAGATCGACGGCCCCCCATTTGTCTCTCCACATCTCGACACCATCCACCCA
TGGCCTTAAGCTTCGAGTGTTGAACTTTACGCTAGCGACAGAAGGACGTCTCCCAAGCTTTCATTGTGACGAATTGAACGTCGAGGCACAGCTTGTCGCG
AATATCTCGCTAGCTTTCGACTCAATCTCGGGGTGGACAGTCCCCCAAGAGGAGCTAGACGTCAAGCTCATGAGCTTCGTCTATTACGAGCGGGAAGCCA
ACAGCACAAAGCGCGGCAAGGACCACGATACCATCATGAAAATGTTCATCAACCGCATGTTACCGTCAGTGGTGAGGGGTGCAGCTCAGCGATTATTTTG
CGTAGAGCTTGGACCTCTCATCCAGCGCCGTGAAGCACAGGTCGTTCTGTCTGGCGAGATCCAAATCAGTGGGCGGAAGCTGTCTGTCTACGATGCTGCG
CTGAACAATTCAACTACGGACGTTAAGCGTGCTAAGGATCGAGACTTATCGGAAATGGCGCGTGAGGTCATGGCCATCTCAGATGACGAGGCTGATGTTT
TATACGCCATCTTCAAGACATTCGTCGATAcgcacaacaacaacaagacaCTGTTCGGCAAGGTGGAAACTCCCAGACTGTGTATTCGCAACTTAATCAG
CTACTTCGAGCAGTTCCACCACACACCGCATTTAAAGGCACTTGCAAGCGAATTGTGGGGTCAGAGCATTCACCTGTTGTCATCAACATCTTCAGATTCA
CCGTCTCGTACAGACCATGGGGCAGCATCTCCCTTCTCATCGATTATCAACAGTATCGAGCAGATCAAAGAATACCCAGTGGACGTGTCCATCTCGCTAG
TGGATGTTACCTTCCGCCTCGATCTTTGCGAGGGTGCAGCAACGTATTACATGGCTCTGCAGCGCATCATTCGCAGAAGTATGGATACAAGCTCGGTTGG
CCTCGCAAATTTGGCTGAGTTGCGCGATGGTACTTACCTGCAGAATAAACTGGCGCGGTTGGACGCTAGGTACGAGAAAGCCACCCAGTTGTTGTCCTAT
GTCACCACTAACGTCGATGTCCTGGGCGTTATCTTTCGCGGTGTGCTCCCGAGTGGGTTCATGAGCCGGTTGTTCGTAGAAGCACGAGACTTTTCTGGAA
AAGGCCCATGTGCTGGATCGGTGACAATCCCCCTCACCGATTTGGCGGCCTTATCCTCTCGTGACGGCGTGGCAATTGGTACGCAAGATATGAACGACCC
TCCAGCGTCCGTCTTGACTAGAACGCATGAAAATGGAGCTTTGGTGTTGTCAAGGTTTTTGCTTGATTCGCTTCAGGACAATAGCCCGGAGGGTGAAGTA
GCGTTGCCGAACGATCGCTTGAAGGTTACCGTAAAGAATCCATCCGTGCGCGTGCTATTCGAAGTTCCATCAGACATATCGCAGTTGGAGCCTGGACAGA
CTCTCGCTCCGTTTGCGGTATCTGTGGTCACCGATGACCCGAATCAGCCTCCGAAACTCAAGATCGAAACCGGGGACTTTGGCAAGTGCCAATACACGGC
TGAGAGAGTCACTTTCAGCGGAACAGTCTGGCAGTTCTTGCGGCGAACGCAAGAATCTGCTGATAGTGTGCTGGGTGCACAGGATCCAGCGGCGTCTGAG
AGAATGGCCAACACAACCAGCACGCCAAAAGAGGCCTCTGGCACTAGCAACGGAGAAGAGGACAGCATTTGGAACGAGTACTTGGAGTCTCCGTTTTTCA
GCCTTCGGTTCCACTTTTTCAGCTCGTGCCAAGTAACGCGCGAccacatcttcttgagcatcGGTAGTGCCTCGCTGACAGAGCCTAAGGTGGTTCAGCT
CAAGCACCGTGTCTGCCTtggccagctgctgcaagacCTTGACATGCTCAGCGTGGTCGACTCGAACGCGTCCAGAAGGAAGGCAGGCGCGAGgttccag
cacgcgctgcatcAACGAGCCGCCGACGCAAAGCGACACGGTCCGTCCTCCATGTTTAACTACTCGCAGAGGCAGACGCTCTTCTCGCAGACGAGTTTTA
CTTCTAccgacgacttcgacggcACCAGCGAGCCAGCGTCTCTGTATGAGACCGAGGCAGCGGATAGTGAGGCCGATACCTCTCGACAAGATTTCCATGA
AGTGGACAGCAGTGCAGTTTCAAACGACGCAGACACTCAAGTTGGCCGCCAATTGCCATCGCCAATCCAGCCCAATATTCGAGCTGTAGATCGGCACAAG
ACTGCTCTTTACTTTTGAGATGCTTAAATGTGGTAGTCAGTGCTACCGCAACATTACCCGGTACTTTGCTTTTGGATCCGAGATTTTCGGAATGTTTTAC
CAGCTTATCAAGATGCGGGTGGCGGCAAGTTTTGTACAGATAAATATTACGCACACACGCCCGACGACTTCATCTAAAACGGCGGATAATGCGAAAATTC
CATGATAAAGTGGGCTGGGcactgctgctctgctccagcactttTGAAATTTTTGAAACATTGGAGGCAAGCATCAGTTCTAACTGCCCGCCAATTGCCA
CCAACAATCTGTTCGCATATCGGCAGTCGCTCCACACATGACCAGAATTGAGCTGCCTCCTTCTGAGACGCTCGGCGTTAGTGCTGATGAGGTCGCCTCA
TGTTGAGAGGCGACCTCAGTGTCAAGATGGCTTCATTACACATGAGAtatttcaaccaatcatcTCGTTAAAATTCGACAGTGTtaagatggctacatta
cACATCAAAAtatttcaaccaatcatcTAAGTTCCATTCAAAATACCTTGCGTGGATTGGCTGGAAAATCCGACGATGCGTTCTCTACCTCCCCCAAGCA
TTCGTGCTTCTACCCTTTC