Description :
From Genome Similarity Track
Location :
scaffold_309:580- 1909
Transcript NameFunction/comments
Pl_106259hypothetical protein PHYSODRAFT_332764

Sequence
1329 bases(100 bases per row)
CGGTCAAAGTTCCACTGCACACGCATCCCATCACAATTGGCGTGTTGTGCTCCACCGCGTCAAAACGCGTAGGATGCCAAGCGCTCCGCGACACAACTTT
TAGGCGTGACTCTGAGTAGGACACGATTGGCAAGGCCATGGATTCGAGTTGTGCCGTCGAGCGGCTTATTTTCGTCTGAGGCTGTGCCTAGGGGAGAACT
AGCTTTCGGGTTATCAGTCAGATCGATAAGAGGCGCTGTCGACATAAGGAACGTCTCCGACGCCACTTGCTGTTCTGACTTGTGATTCAACAGTGCAGCC
GCTGGCGCCGATTGAGTTGCAAGGGCTACAGCAATGACTAGCAATGGACATGTGGTGAAGTCATGGTCAGGGAAGAGAGAGGCTCTGCTCTTCGGACGTC
TTGGCACGGATGAGGCGGAGGAAATATTCCCCCTGCGCCGATGGACAAGTTCACCTTGCGAAGTAGCGATAGATCGTATGTGCGTCCAAGAGAAACCAGA
GCAAGCATAGCAGCGCGAAGCTGTGGCTCCATTTGAATAGAGATATACCATCACCTGCTTGAGCGCATTCTTCGTGCACGCAGGTGTCTTCTTAACAAAG
TTTCCGGACTCTCTCTCCATGCAATAATGTTCCAGCACTTGACCCTGTTAAAAAAGTAGTAAGTTCTCCTACGAGGTTGCGGACCCTCGTCCTACCTGCC
TCGGGTCATCAGCTCTGACTCGGGTTTGCGCCACTCTCGGCAGTGGCATCGACAGACCCTTCTCCAGCAGTGCCTTGCCGATAGCTGCTCGGTGCTGGGG
AATCGATCGCGCAACCACTTCTTGGTTTGTCGAAAGTACTGCATGACAGAATGTCTAGTTAAGAGCTTTCCCTTCTGTCCTTCCTTGAAAGCAAGATGCA
GTCCAAATTGTGCACGACGGCCTCCAGGACGAGGGAGGTGTTCTCGCACTTCATTCACACCTCTGGGGCTTCCGCGTCACGCCTTCTTTCTCCAGAAACG
TTTTGAACAAGCGTGTATCGCCCTCTCAAGCATGCTTTGTGTTGATGGGTGTGCGATCGTTTAAACTTATTTTGGGTCAGAGAAGTCGGAGCTTGTGTGT
TATTTGCTAATGAATAGAAGTTTGCATGAGGATATCAATAATAGGACGGAGGTCTTCGACCCGATCTGTCTGAGCTGTGCCAGTTTGACCTTTACAGAAC
CGACGGGTTCTGATTGGCTAAAATTAATGTAAACACAAAAGTTGACATGTTAATTAAAATACCATTTCATCTCACTGATTGGATAATGTCATCTATAGTG
AAATCAAGTACTGTCGGCATTTGTCGGTA