Description :
From Genome Similarity Track
Location :
Scaffold_2130:580- 1671
Transcript NameFunction/comments
Phymu_g13905Avr4-associated TDF-like protein

Sequence
1091 bases(100 bases per row)
CTTACAGACCGGGGTACAATCCAAGGAAACCTGGCGTCGGCTCGCCCTCCACCTCATCGATGTACAGCGTGAACGTCTGGCGCCACGCCTCCACGGTCGC
ACGGTCCGCCATGAACTTGGGGAACTCGTCCACGTTAGCTTTGCAGATTTCCCACGGGTGACTGGAGCCACTGTTGGGGGTCAAGTCCACGcgcacgttc
tcgttcatgACCGACTTCTGCACGTCTTCGGAGATGGCCCAGTTCATGAACAGCTTGGCGGCCGCCGGGTGCTTGGCCTTGTTCAGGATGGCGATGCGCT
GGCCCCACGCCAAATACTCGTTGCCGCCGTCCGTGACGAACGTGACGTTGGGCGTTCCCTCCGAGTACGTGCCGACGCCGATGACCTTGTCTTTGGCTGT
GACGAGGTCGCTGGGCGAGTTGGATCCGCGGCGGAACGTGACGTTCTGCTTGGCGAAGTCTTCGACCCAGCTCCAGCCGTACTTCTCGACGTAGCGCTTg
tacaagaagagcacggcgtcgtcgtcgttcggGTAGGACGAGGCGATCTTGCCGGCCCACTGAGGGTCCACGAGATCAGCCGGCGACTTGGGCGCCGCGA
GTCcgtccagcgccgcctcgtcgtacaggaagctgaaggtgaacATCATGTAGGCCATGTAGGCGCCGCGCTGGTCGCGGAAGCCGTCGTAGACCTGGGA
GAAGTTGGCGGGTTtgtactcgagcagctttccCTCCCGCGCCCAGCGAGGGAagtcctgcagcgtctgcagcgccactAGGTCGGGCACCAGCGTGTCG
GTCTCCAGTTGGTTGTCGATGCGCACGTCGTGGTACTTGCTGTAGTCTACGATGAGCGTGAAGTTGATGTCCGGGAAGGCCTTACTGAACGCGTCGTGcg
tcgtctcctgctgcgaCGAGAAGTCTCCGCCGTGGTACATGACGAGGTTTCCTCCTTCGGCGATGGCATCGGCGTAGAGCTCGTCGAGGGTTTTGGTTTC
TTCCTGGACGGCGATGGTGGTCGATGCGAGAAGTGCGTAGCAGACGGCAGCGAATGGTGCGAAGAACTTCATCGTTAGTTGTGTCGGTAGT