Description :
From Genome Similarity Track
Location :
Scaffold_324:58- 3763
Transcript NameFunction/comments
Physo_125653hypothetical protein
Physo_144915hypothetical protein

Sequence
3705 bases(100 bases per row)
TGCTTCACTCAAGCAATCTCGGACATGTGCCTTTACTTCAAGCATGACGGTCCCGACATGGTTGTCGTTGGAGTGTACGTCGACGACCTTCTGGTGACCG
CAACGCGCGAGGAGTTGGTGGGCAAGTTCTTTGAGGACATGGCGGCCCTATCGATAAAGAACCTCGGATATGTGAGCCGATTCCTTGGGATGCGTGTTCG
CTATGATGATCACCATGGGTACGAACTCGACCAAGAGGTAGCCATTGACGAACTACTGCGCGAATTCGGCATGGAGAATGCGCACGGAGTGCGAACACCG
ATCGGAGAAGAGTGCAACGACAAACCAGCACTTCAGGAGGAGTTACTCCCCGCTGTGGACAAAAGTGGGGGCCTACGCTCCGGCGATTTCAGTCTTTGGT
CGGTAGCCTGCTGTGGCTTGCACGCTGTACAAGACCGGACATCGCTTTCGCGGTCCACAAAGCCACACGTCAGACGCATCAACCTCGTCTGGCGGACTGG
AAGCTATGTAAGCGTGTGCTTCGCTACCTAAGTGGCTCAAAGAGCGTCAAACTGCGAATGAAAGGCTGCAATCCTGGCGCGGCGCTGCGACTCGAAGGAT
TTAGTGATGCAGACTTCGCGGCGGACAAAACCGACCGCAAGAGTGTCACGGGAGGCGTCGTGCTACTGGACGGGATGCCGATTCTGTGGGTGTGTAAGAA
ACAAGGTGGTGTCGCGCTTTCGACTATGGAAGCAGAATTTACGGCTGAGTCGCACGTTTGCCGTGAATTGCTGGGTTTCCGCCAGCTACTGCTGGAGATT
CGCTTGCCGGTGCTGGAGCCGATGCCGCTCATGGTTGATAATCGAGCGGCGATAAAGCAGCTTCGAAGTGAGTCGACGTCGGCCAGCGCAAAGCACATTG
ACATTTGCATCAAGTTCGTGTACTCATACACTCACCAAGGAGTTATCGAGCCTGTCTACGTGGAGTCGCGACTTCAGCTAGCTGATTTGCTGACGAAGAC
ATTGTCGGCGCCGCGTCTCAGCGAACTCCGCGACTTACTGCATTTGAGTGATCCCAAGAAGTCCAGGTACGGCGATGCTGCCGAGGAGGAGTGTTAGAAA
TGGTGACTTGGGTTGCAGGTCGAACTGCAAGTTGCAGTCGAGCTGCGGGTTGCTGCAAGTTGTAGGCGAGCTACAAGTTGCCAGCGAGCTGCAAGTTGCA
GCAGACGGGAGCTGGAAGGTGATCTGCGCTTTGCTTGTGGCGGTAGCATTGCCACCTGCATCTATTTGTATTTGAGAGACTGGAGATAGCGCAGGAGAGA
CCTAGGAGACGTAGGAAGCAAGGGCTACGAAGGGTATGCGCTAAACGTTCAATCTCAATCACTTCTGCTTTTACTTTCAAGCCCACAAGCGTCCTACACC
GTCGCGACACCTTCGTTCAGTCGACGCACCAAGAACAAGTCCAGTGTGTTCACACAGCGGCATCGATCCGAACCGGATGAGACCAAGATCCCCCAAGATC
CACAGGCGGCACCGAATGAGCCGCAGATCCAAGGGAGAGGACCAGTTTCAAGACGAAGAGACGGTGTACCCAGATACCTCCGTCATCATCTGATGAGTGT
ACCCGAACAAGTGTCGCCGTCAACAAGTCTCCTCATACCGAAACCAAGACAAGCATACTGAAGAACTGCCAAGAAGCACAAGCATACTCAAGACAAGCGA
AGCATAGTTAAACCTACATTATAGTCAGCGAAGTGATAGAAGATAGCTAGCCAGACGCAAGATCTAAACAGAAACCAATTTGCCGAAGAACACGCGGACG
ACTCTGTGCTCGGGGCAGAAGTAGCACCCCGACTTTGACCTCTTTAGAGCCCTCCAGGAGACTGCCTGCGCGCGGTCTAAGCCAGTTTAGGGACGCTTCC
AAGGCCTCACTGGTGTAGCGAGCACTGGTGTAGTGGGGACTCAAAGGTACCAAGGCAAAGTCGGCAGTGACTGGGGTGTCGCACCCCGGAGTGACCTGTG
AGAGCTTTATTTTCTATTTGCGTGCTCTAACCGGGCATCCATTTCATATTCCCTACTGTGTGTCTTTGGTGGTTGAGGTAGTCACACACCCCCAGACCGA
ATTGATTGACTACTATGTGATAGGACTGAATTATATTTTGTATTGTTCCCTCATTCTGTGAGGGTGGTGCGCGTAAGTGAGTGTGCATCCAGGGCTGGCC
AGTGCCTTGGGTGACGGCTCCGAAGTTGACTGGTGTATAGACCCCCCACCCAAGGGTCTCAAAGAATAAGTGGTGGCTGTATATTGTGTGACGTTTAGCT
CGGCATTGTATTTCTGTGTGTTGGTTATTCTGAATTACGGATCTGACTGTGGTCCCTTTCATTCGGTCTGACCTTCTGTTCATTCGGTGTGGTTTATCCA
AGGAAGACACCCAGCAGACTTTATTCTGTATCACAACAACTCAACTCGGTGAAGTCCGGCCCACCAAAGGTAAACGATACCTATAGGGGTTGACACAAGG
ACACACGCCAAACCCCGGACCGCATTAATGCGATTCGGTGCGTCCAAGCGGTTCCAGGCCCGGGTCATTCAGTGTCCCGTGGGGTGCTTATCGCGTGGAC
AATCTCTGGTACTCCGAACCCGAATTTATTCGGTCCGGCATAGTGCGCTATACACCCTGGACGATAAAGGGTTCACCCGCCTCGCGTCAGCTGGTGAGCG
TGCCCGGATTTGGTTGCCTAGGGTTTCACCGCGAGTTGTTTGTATTGATTTGGTCTTAAGGGGTGTTTCTACTGACTACCTGGACTAACGGTTTGGTTAT
GACTGGAAGGAAGGAAGCACGTGAAGGTGGACGCGGAGGCGGACGCGGTGAAGCGTCGCGTCAGTCGCGTCGAGGACAAGGGCTGCCGCCGGAGGAGCAC
AAGGCCCTGGACGACGTTGTCCGGGAGGCTCGGAAGGCTGGTGCTGAGAAGCGCAAGGCGGCCCTGGAAGAGAAGAAGAAGGCGTCGGCGGCCGTTCAAG
ATCAAGCGGCCCCGGAGTCCTCCGTTCTGGATGCGCACCAAGCAAACCAGGATGAGGCTCCGGAGGCGGACTCGACCGAGTCTGTGCCGTCGGCACCGAA
TGTGTCCCAGACCCGGCGACGGGACTGGATGAGGGTGAGTCCGCAGGATGATGAACCCGCCCAGGCGTCTGTGGGAGGCGCCGATGAGGTTGAACCCCCG
GCTGAGGATCGAGTTTCGGACTCTCCCCAGCCGGATGACGAAGTCGAGATTCTGGATGAAGCCCCGACGACCAAGCACGAAGGCCTGCTGTCGACTGTCC
AAGAAGACGGCGTACTGAACGACGAAGCCGAGACCCGGTCTGCCCCTGCGCCATCCGGTCCGGCCGCGACTGCCCAAGCACCTGCGCTCAAGATTGAAGC
CCAATCCAGTCCGGCGCCCTCGGATTCGCGAGGACCCGACGAGACCAAGGCCCAAGTGAGCGAGGCTCAGACTCAGGCGTACGTGGCCGAGCAAGTGCGC
CGCTGGGAGCAGCATCGTGAAAGCGCCGTGGTCCCGCTCAAGGTGGAGTATGCCTGGCCCGAGCCGGCACCCGACTTCACCGAATGGTGGGCCGCCGCGC
TGGCGACGTCGAAGTACCTGTCGGACCGAATGGCGATGGCAAGTCAAGACGCTGCATGGATCGCGGAGCTTGATTCGGTACGGCTTGAGCTGTGTCTGGC
CCAGG