Description :
From Genome Similarity Track
Location :
Scaffold_1366:58- 3150
Transcript NameFunction/comments
Phypl_g13228hypothetical protein PHYSODRAFT_497923
Phypl_g13229hypothetical protein

Sequence
3092 bases(100 bases per row)
TGACCACCATCTCGTTGTGATCGAAGTACTTCACCTCGTTGCATGCGAAGTTCATGCTGACTTTGTGCTTACGCATGAAGTCAACACCAACGAGGAACTC
GTCAGTGCATCCCTCAATAATACACGCTTCCATCTCGTTCATTTGGCCGTACGCGTTGCGCATCATGAACGACCACACGCCCACCACCGCCAACAGGAAT
CCGCCGATCCTCTCCACGTAGTCGACGGGAGCGTCTTTACGCATCTGCTCGCCCCGCTGCATCCAGCCTGTGCCTGCGACGGAATACCGTGCGCCATTGT
CGAGCTTGATCAGCAcccgctcgtcgtcgaccacCATCATGGCTGTGGGCAGCccgtcgtcggccgccaCATCCACCTCGTCCGGTTCACCGGTGGTCGT
CatcaccacctcgtcgtcctgctcacgctgcacgaggcTCACTTTCGCACTCGCACAGCCCCGCGTtgttgtcgccgccgccttcgggcgtcgtgctgcc
atCGCGGACTTCGCGTCGGCCTCTTGCTGTTGGCGCCGAGTCCGCGGCTCGTCGCGCAGAGCGAGTCATCGAGGAAGGAAACGGCGCGTGGGGCTTCCCC
GTCGTTCTGGTCAGGAAGAAAGACGGTGAAGTGCGTTTCTGCATTGATTATAGGGCCCTGAACAAGGCCACTAAGCGAGATGTATATCCTTTGCCGCGGA
TCGACGAGACCCTCGAAGCATTGAGCGGTGTGCGGTTGTTTACGACCCAGGACTTGAGATCGGTATACTGGCAGATTGGCGTCGCGCCGAAAGACCGTGA
CAAGACTGCCTTTACGACGAAGCAAAGGGCTATACAGATTTGTGCGGATGCCATTCGGGTTAATGAACGCTCTGTCGACATTTCAACGGATGATGAACGG
AGTGTTGCGAGGATTGACGTGGTCGACATGTCTAGTATACTTATATGACATTGTGGTGTGTACACGTGGTGGTATCGAGCGGCACGTGGTCGAACTAGCT
GTGGTGTTGGAACGTCTGTCGGCAGCTGCCCTGACACTAAAGCTGAAGAAGTGTGTCTTcgccacgacgtcgatgGAGTACTTGGGCcacgagctcagca
gcgacggtgTGCGGCCGGTGGAGCGGTTGGTGACGGCGGTTGGTGAGTTTCCGCGACCCGTCGATCCGGTCGATGTGAAACGGTTTGTACATCTTGCGGG
GTACTACCGCAAGTTCATCGAGGCATTTGGTTCTATGATGGCGCCAAGGATGCAGCTCCTCAAGAAGGATACGGATTGAGAATGGACTGAGGACCAGGAG
TTCGCGTTTGAGAGAGTGAAGGCGGCACTAACTACGCGGCCCCTGCTCATCTACCCGAACTTTGAGCTTCCTTTCCGGTTGGTGACAGATGCGAGCACGA
CAGAGCTCGGGGCTTGCCTCATGCAAAATCAAGGACGTGGCTGGCAACCGATAGCGTTCTCCAGCAAAGTCAATAGCAGCGCGGAGGCGAACTATTAGTC
CACCACGGAGCTCGACTGTTTGGCGGTGGTTTAGTCGGTGAAGCTGTTCTGCCCGTATCTGTACGGCAGGACTTTCACAATCATCACCGACCATGCCTCA
TTGAAGTGGCTGGTGACGCGACCGAACTTGGCTGGACGACTACACATATGGTCACTTACTCTACAAGAATACGAGTTTGAAATTGTCTATTGTCCTGCAA
CGACGAATGTGGTGGCTGACGCGCTGTCCAGGGCGCCAGAAACGGAAATGAGTACGGCGGCAAGCGACAAAAAGCgagacgaagacggaggacgGGAAGC
TGCCCACGATCTCAATGATCAGGGAGGCCGAGAAGTACGCCAGACGGACGACGGCTAggccacgagcggcagcaacggacaggacgacgacagctgaggt
gacagcagctcctgtgGTAACTGAGACCGCGACGAGTACGACAGAGGCAGCTACGGACGACGGGCGGCTGGACAGATTAGCAACGACGGCCAATCGGCCA
CTGACGAGAGCCGCCAAGAGCCGCCAAGTAGCGGAGGCAGCGACCACGCGACGAGCGACGCAGAATGCGTCGACTACGAGTGACGACGAACGAGCTACGG
ACGCAGGAACGGATGGCTCGGTGCCGACGGACGCGGCGATGTCGGCGATCAGTgcggagcagcacgcgaAGACGTTGGCGGACATAGAtacggacgacga
cacccTGCAGTCGACGATAGCGGCAGCGAGCCACACGGGCACGAACGGCACGACGGTGCAACACGCAGGACGAGACGAAGGACAGAGTCGGCGGAGAGTC
ACGTGGTCGCGCCTTCGGCCGAAACGAGAAACGACGCGTCGGTGGTCACACAGATGACGGACGATTCGGTGGAGTCGACGACGGGCAGCACAATGGAGCA
ATCGACGATCAATGCTGTGACGTCCGGTGTCGCGACGTCATGGAGCACGACGGAGCGCCCGCTGATAGCTCCACAACGGGCCATCAGGACGAACGAAGAG
CGCCGGGCGACAAGAACTGCTCCCAAGGTGCGGAAGCCGAcaagcagcaccatggcggGTGGCACGACGGCAACGGACGAAGCGGACGGACGAGAGAACC
AAGTGCGGATGGACGGATACTTGTAACGCAACAGGAAGGAGCGATAGCAGCTCAGGCGATGGTAGACGTGCCGGAAGACGCGGACAAAGTGGAACCACCG
ACGAACTACACGCTCCAGCGCACAGACGACGAGATATCGGTGGCGCAGCGACGTAGTCGACtggtgcagaagctcgtcgaggCTGGAGAGTATCGATCCA
TGACGTTGGAACGGGCGTACGGGCTGGTAGTCGTGCAAACACAGCACGGCCGGCGAGTGGTGCTGGCACCCTCGATGTGGGCCGTGATGTTCAAAGAAAT
GAATGTGTGGTGTCGGGAATGACCGGAGAACGCCGGCGCCCTCGTCACCACCGTTGGAGGCTTGAGTGTCGAGAATCCCGTTGGGGCTGAATGTGTGGCC
CAGTGCTGATTGGCCCAAAACCCTCGTGGAAGAGTGATGGTCCTTGACCGAACAagtgtgcgccacaccacgaGTGCAACGGCCGGACAGCA