Description :
From Genome Similarity Track
Location :
Scaffold_2378:58- 2973
Sequence
2915 bases(100 bases per row)
TGGAACTGAGGAACAGGATCGCGACCTCGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTC
AGCAGCTCTGGTGCAAGAACATGAGGGGATCTGTCATCCAGTCACCTTTGTCAGCCGGACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAA
GAGATACTTGCGCTCCTGCGCGTGTTGGATCTAAATTATAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCCACGCTAGCCTGGCTGT
TCAAGTCGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCACCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGAT
CCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGATCGCCCCTAAGAAAGAGCCCAAACGCCGGATCCAGATC
CCGATCCCGACGGTACAGGTGGATGAGGATCTATACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGT
GGAGATTGCCCGGATGGGATGTTGTACGGGCCAGATCCACTTACGCGGAAGGGCTCACCGTCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGA
TTTACTAAAGGGACAGATCCAAAACGGCTGGTGATTTGTGGGGAGATAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCC
TAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGCGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTT
GGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTTGTTACGTTGAACCGACTAGAATGAGTGGTGGTA
GTGGGGTCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAACCCCCAAATTCTCGAGGAAACATTTGTGAAGA
GAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGTATGTACGAGACCTGAGTCGGGA
AGATGCCAAATCCTATAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGATCCTGCTCTTCTATTGCCCCCCCCCCCTACGAAGAGAGTCAACGAG
GATCGGGCTGGATTGATGAGACTGGTGATGCCGAAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTG
GTCGGACCTACTAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACAGTATGTCGGGGAATGTGTGGATTGTGAGACAGGCAA
GGGCAGACCCACAATCGAAGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAGTCATAGCCATGGATCATATCCCCTCGTTGCCCAAGTCG
TTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACTTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCGCAGACCATTGCTGAAT
CGTACGAGGAGTGCGTTTTCCGAAGATTTGGAGCTAGCGAGATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCG
GATCTCGGGGCAGCGACAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTACAGACGATCACGAGAGCACTCAAGATG
TACGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGGCTCCCCTTCGTGATGAACACCGCCCAAGACAGAATCCGGGGTGATACCCCAT
TTTACTTGGTACATGGGTGGAATCCCCAATTCCCCCTGGAGAGCGACCTTCCCATTTGGGCCACCCCCCAGAAAGAGAAACCGAGATTCCAAGAGCGAGG
GGCGATACCACATTTCACAAAAATACTTCCCCGGCAAGGCTAGATCCCAGGTGAACGAACGACTGCGGAGTGCGATACAGGATCAAGCGGATCGACACAA
CGAAGACGCCCGTCCACATCAAATCCAAGTGGGATCGTAGGTGTGGCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCACAAATTGGCCCATCTATGG
CATGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACACGCGGTAAGGCTGGAAACGGCAGGTACCGAATATCGCCTGTTTTCTGTAGTACACGTATCCA
AGCTGAAGTTGGTCAAAGAATATCCGGATCGGCCGCAGATCCGTCTTTCGGTGGATGGATCCGGCCCCGTCGACTTCGACGAAGTCCTCCTACCAGAAGA
TAGTTGGAACGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAAGATCACCGATATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAA
TTTCTGGTGTATTAGCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGCGAAGCATTACGCTATGATTTCTTGCGGGATCGTACGA
ATCGGAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGGAGGGGGATCCATGGATGTAAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCC
ACAGGAAGGGTGTGGGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGGAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGA
GGAAGGAATGAATGT