Description :
From Genome Similarity Track
Location :
Scaffold_728:58- 2483
Transcript NameFunction/comments
Phyra_86460Hypothetical protein

Sequence
2425 bases(100 bases per row)
GGCTGTGAATACTGACGTTTCGAAATGCGGAAGTCACATCGCCTGCCATGGCCTTGGTCTCAGCATCAGGGTGTTCCCTCTTGGTTCGTATTATCTCGGA
AGCGACCGCATCACAGTGTCGATAGGCGGCGCTTGGAATAGCGTCCTGGTCTGTGAAATCGTTGATCGAGGCGCCGTCAGGGAACGATAGATCATGAATT
GTCCTTCCGGACGTCAGCGGGTCACCACCCGCCTTGTCGACTATCCCGAATGGGCTGACGAACACTTCTGGCCACAGCGAGAGGAGATCCAAGTCTAGTA
CAAGGCACCTCCATGCGTCTTGCTCCTTGCGGACGTTCTTGCGCAGTATGTTCACCCTCTCAGTTGCCGATCCATGATTGTCCGGTGGATGCGATTGATG
CGGCACGTCCTTCTTGAGCTCCACGCGGACGCCTTCCGCTGCGATAGCTTGCCGTTTCTCTAAATGCTGGTACAAATGTGCGATCACTGCCGGAACCATT
TGCTTGTTTGGACGGTAATCTGTTTCCGTCTGGCAGCGAACAAGTTCCGCTAGAGCCGGTAGAGGCATCTGTGTCCGGCGGACAAATTCGGAAAGCGTGC
GTTGCAGTGGCTTGTTGAGTAGGAACTCGGTGCCGCGTGACGATTGCCGGGATGTAGGATACGACGACGTTGGAAGCCGCAGCCCGACCTTCCCCAGAGC
CTTGTTCAGTGATAGGCGCCGTAGTGTTTCGAAGCCCGTAACGCGGCGGACTGCGTTTTCGGTCACCCGAGTTGCCCTTGTACAAGTTAATACATCGTGC
ATTTTGCGCGTTGCGCGTTCAGCGAAGTCTACGCGTGGGTGCATATCTTCTTCACATGAGTCCGTTTCGACTACGCTAGGCAGTGAAGCCATCCCAGGTG
CAGGAGCTGTCCTAGGCTGTATAGCCATTTCAGATGCAGAAGCTGTCCTAGGCTGTATGGCCATCTCAGGTGACTGATGTGTCCTAGGCTGTATGGCCAT
CTTAGGTGCAGCTGACTGTATGGCCGTCCGAGTCGCCCTAGGCTGTATGGCCATGATAGGTACGGTTGCATGTGTAACCACTTGACGTTCAACATTCGCT
GTGGTCGCAGGCTGACGTGGTAGATGCTGTAGCGTGGTCTCGCTAGTCAAAATTCGTTCGCGGCGGGAGCATGAAATTGAGCTTGAATTTGGCTTCAAAT
CCGGGTTTTCATAGGGTGGAGTGCGTGTAATCCGCGAAATTTCCCGCGCCGAGCGCGAACGATCAGCCCCCACCCCACCCCTATTGCCTCCCGGCACGCC
TTCTGCCCACGCAGCGCCGATACACACACTTGACTCACTGGATAAACATGGGATGCTATAACATGTGTTATCTTCCTTATCCCAGTCTTCGCTCCGAAGT
GGCGGAGAGTCGTCACCACCTCGGCTCCATCAGTTCCGTCCGTTGCGCCGCCATTGCTTCGCTTCCTGGTCCCAGCCTCTGCGCCGCGCGTACGTGTCTT
GGGCCCACTCCTTCAAGCGCCGAGGAATGTCCGCGGATGGCCAGCCGTGGACGCGCTTCGGGTGTCCGCACCTGTCGCGGTTCCCGCCTGAGCACATAAC
GCCTCCGAGGAAGCGGAGGCAAGGCTCCTCACCGCGCCGGTTGCTCGGGATCAGAGCTCGGATCTCGTCCGGCACACTCTTCTCGCGCCGCCCTTGGGTT
TCGCGGCTCCGTGGCTGATCTCGCGCTTCGGGGTACCGGCTTGGTGGAGGGGCCGCAGATGCCTGCGAAAGCGTGTTGACCAGCGCCATGGTCCACTCCG
ACGACTTGTAGTCGATTGCAAGGATGGCCTTGCTGAAGCCACCCCACCAAGCCGGGCTGTCAACTTGAACGTGCCCGAGCGCTGTCCCGAGCCACTTGTT
CACGTAGAGGAGGACGAGCTTCACGCGACATGGCTGACCGGCGGGGTCTGCGGACTTGTTCTTCGAGACGAACACGCGGAGCCGCTCCGTGACCAGAAGC
ATGTGGTCATGCCACATCACCTCGCCCATCCTGGTCAGTCCGTGGATCCCGTCGAGGATGTCGTCGTACGCGCTGCAGCTGGTGGCCGCCGTCGGAAGAG
TGGCCGCCGGGTTGAAGTCCGACGCGAAGTTGCAGTTGGACGATCCGGCCTCCAGCGCTTCTTGTTCGTTCTCCTCACGGAAGTGAAGAATCGTCAGCCC
TCGTGACCCAAGTCGACCGGAGAAAATCGCCATCAGCACGGCCGGACTTGTCTTGAACCCCACGCACTCCGCCTCACGCAAGCCTAGCACAAACGACATG
GGAGACACGGGCTTACCTTCAGTCGGAGTGAGCCCCTTGAACATGCGAGTCGCCGCCAGCACGTGCGCTTGTGGAGGATGGTAGTCGCCCTTGGCCTTCT
TCGCTTGTTCAGGAAAACTGGCGCT