Description :
From Genome Similarity Track
Location :
Scaffold_582:5799- 7227
Sequence
1428 bases(100 bases per row)
GTACACGTTCGTCACTTCGGTACGGATAAAGCTCATCGTAGTCAACAAAGTCTGTAGCCATGACCCCATAACTACCGTGCTGACTGCCACATTCATCCAC
AAACTTGGAAAACAGGACCGTGTTGGACTCCACAGTTGCACCGGATGAAGTAAACGAAGCCTGCCGTAGCTGAGCAAGCTCTGTACTTTCGAAATCGTTG
TCTTCACGAATCGCGATGTTGCCAAACAGCTCGGAGAGGTACATCTCAGCGTTGAGGACAACCCCGACGGTAGCATCAAACACAGCCTTGCTACTTTCTC
CATATAACGGCAGTACGTCGAATCGCACCAGACAGTAGTCGCCGTCAGGACTGTCCAAGCGTTCTTCTTGACTGTACGACGACCGAGGAGCAAGTCCGTG
ACATCGGACAGCTAGATACCGCGTTGCATTGTCAAGCATGCTGTCTCTGAGAGCCAGCAAGACTGCACGGCGTTCCGTTCGGTCCGAACCCAGCCGGACC
ACACTTTGAAGTGGTTGCAGCGTTCCCAAGCTTCGTTGCTGCCGATAAATGCACCACAACTTCACGTTAAATTCTACAGCAATTGTGCTGAACTAACAAA
AAAGCGTACCACGTGTCCAGCGAGAGCTGCTTGAGTCGTAGCCAGTGTCAAATGTTGTTTCTGGATGAACTCCAGCAGCACCGCGTTTTCCGCTTGGGTG
CGTTGAGTAGCTTTGCGAATTTCACCTTGATTTACGAGCACCACAAATTTGAGTCTATCCAACTCGTTTTGCATCTTCTCGACTTGCTCCACCAACAATC
GCTTGTGTTCCTTGCGGCCAGCGTAGCGCGTTGGTGGTTTGAGTTTGTTTGGTCTTGGCGTCTTGGAAGTTGGGCGCTTTGCCTTACTTCCTACCGGTAG
CATTGGGCTCATCATGTCTTTGATGCTCGTTTCAGATCTTTCCCATATTCTCCGTACTTTACCGATAAACCACGGTACTCGCTCGACCGTGTACTTCATT
TATATTCCAATGGAAACAATACTGTGAGATGATCTGACGTATTTCTTACCAGTATAATGTTGAGGCTGGGTTAAGAATGAGCTAGTTAGTGATCAAGACC
ACATGTCCTCACAGCTAAAAGTCATGCCAACATGTAACAAGGATGAGCTGCTACGCAATCATGAGGCAGTCCTCAACTCCTACTCGAATAGTGCACGCTT
ATCGGTCATTGCAGAGGTAGTCAAAGCAAAGCGATGCTCTATACGACTTAATGTGTCCTTGCACTTCTTCTGTTGCTTCGCAAACCACTCGTGTGCCTTC
GTAATTGTGACAGTGAAGGTTCCTTCCCCTTTGGTCGAATTCACCTGGTAGGAAGCCTCAATCTGGCATCCCGCGCGGTTCTGCGCTGCCTGCAGCTCTC
TAAAATGGTAGTCCCGTTTGTTGGTTCA