Description :
From Genome Similarity Track
Location :
Scaffold_97:57983- 59434
Sequence
1451 bases(100 bases per row)
TAATGATTTCAAGTGGTAATGCCCTGCCGCCTCCAGCGTACGGAGCATTGTGCGACATCGACGTTCAAGGACACGCACCCATTAAGCAGAGAGCTCGGCG
GATACCTCTCCGCCACTTGAGCAAACTTTACGAGTCGTTGAAGGGGCTGCTTCGAGCTGGGTTGATATTATTCTCGAGCAGCCCTTGGGCCTCACCAGTG
GTGATAGTGCTCAAGAAAAATGGTAGGGATATTCGACTATGCATTGACTATAAACTGGTTAATGCGGTTACGACACCGATGGAATACGCTATGCCACTGG
TTGATGACCTGCTTACCGAATTGGAAAGCTACTTGTGGTTTTGCTCGCTCGATGCTGCGAGTGGATTCTGGGCAGTCTTGATGACACGCCGAGCTCGGCA
GTTCTCAGCGTTCGTATGTGCACTTGGACACTTTGAATGGTTACGAATGCCATTTGGATTGAAGAATGCGCCTATGATTTACCAGCGACTAATCGACAAC
GCTCTATGGGGATACGTTCAACCAAAGGGAGGATGGCAACAGTTTGCCGAACGAATGGCTGTTGCTGAAGCGTAGTCGGGAACTCGGCGAGTTGAGCTCG
ACGGAGTCGGCGATTCAACGCAGAGTCAGCTGACGAAGTTTGAAGCTGACCACCAATCACAAGCTGACTGCGATCCGGTCCAAGACCTGGTCAATGGACC
GGACGGCGACATGTTTGCTGATGGAGAACCTGACCAGTCTTCCTTGATTCCGGTGTTCAAGCGGAGGTCGTTTGTCGATGATATCTGTTTTGGAGGGGAG
ACGTTCGACGCCTGCTTGGAGACACTCGACCGATTACTAGCCCGGTTCACAGAATGTCGAATTAGCATCAGCTTTACCAAGAGTATCTTTATCCAACCCA
AGGTTGATTTCCTATCGCACGAGATTACGCCGAGTGGCATACGCGCTGATGCGAAGAAGATAGCCGCGATCGCCGAGCTCGCCTTCCCGAAATCGAAGAA
GGGGATGCAAGCGTTCCTCGGTGCCCTCAACTATTACGGCCGATTCATCCAGAACTTGGCTGTTTACGGAGCAGTACTCTATCAGCTAAAGGATACGGAC
TTTGGCCCTGGGGGTGACCTGGCGTCAGCAAAAGCATCATTCGCCGAGCTCAAAAGACGGGTAGCAGAAGCTCCAATTCTGCGTCATTTCGACTCGGCGA
AAGAAGTCCACATAATGTTGTACGCCAATGAGTGGGCGCTGAGCAGTACGTTGATGCAACCACACGACGACAAGCTGCACCCAGTTCGCTTCTGCGGACG
CGTACTAAAGGAGAACGAACTCGGCTATCATCCCGCTGAGAAAGAAGTAGTCGCGCTGTTGCAATGGCTGAAAGTGTGCTACACTCTCTTGGCGGGAAAG
ACGCTTCACGTCTACACCCGTTTCTCCACGCTGGAGTGGTTGTTTAAGTCA