Description :
From Genome Similarity Track
Location :
Scaffold_128:5798- 7138
Sequence
1340 bases(100 bases per row)
CGCGATCTTTACCATCGGCGTCTTCTTCTTCATCTCTACTGGTCATCCATCTCACGCTCAGGAAGGACAGACGCATAGAGAGAGACAGGAGACGGGAGTG
TGAGCTCTCCTTCCCTTCGTCAAGCTGTCATTGGCTCCGTTTCCGCATTCTCAAACACGCACGTAAAGTGCGATCACATGCGAACTTAGCGTACTTACCA
AAACACGCGTGAAACCTACTTAAACTGTACAAAACAAGGTTGACAAATACAGTTTATGTACCTTGTTTCGGAACGTTGGCTGAAAGCGTGCTGACTGCAT
TCGGAGTGATGGTCGAGTGCCCCTTCGCGACTGACCAGCTGGCGTCACCTGCGCTGTCACAGGAAAGCACCAGACCAGGCAAAACCACACACTCATCGCC
ACTTTGTCAGTCTGAGTACTGGAGCTGCTGACTGGGATTGAATGGCTCTCAACGCTTCACTTGACGAGTCCAATGCGTCGGTCGCCACCAATGTGACTGA
ACTGCGCACGCACGCTGTCTGTCTGTCTGTCTGCCACCTTTCTTCTGATCTCGTCTCGGCAACACTGGTGTTGTGAATGGTGAATGGTGACTGGATGCAC
GTGACTGGCCTGAGTTCCAGGCGCCAAATCAGTCGTAGACCGCATTCCGCGCATCCTGCTGCTTCAAGTTCTTAACACTTTGGATGACTGGCCCCACGCG
AAAGATACACTCCCATTATGAGCAACCTGTCATACCGGTACCTCCAAGCAGGGCATGTGACCTTAATCGAAATCGAATGCTTCGATGAGCGCGTCATGGC
CCCAGAGCAGTCAAATATTGTTAGACTTCGCCATACAATTTTTTTTGGCCATCTCAGCCACGTCACTTGATTGATTCGTGAATTGTCTGCTGCTGACGAC
ACGTGAGCCTGGTTTACCGATGTGTTTGCAGTCACCACCAGCCGCTTGCATGCGCAAGTCAAACGACCGAGTCCAGGTCGTGTCTCACAACTCACTGCTT
TAATTCTGGACTCTGTTGCAGGTTCCTATAGAGCAACGATAGAGAAGTACACTTGAGAAGGCACGCTGGGAATGGGCGGCAGCCTCGGCACGCCAGAGGC
AGACGACTTGCGAGCTCATGGAAGCGGTGCCGCGGCCTCATGAAACGCAAAGATACTCTGGAAACCGCTTGGACGTTTACTAGCATGGTACTGTACTCGT
ATTAGTTTGGAAGGGCACAAGTCACCAAATGCCAATCATGATATGTGCAAATTAAGCAAAATAACATGGCAAATTTTAAGCGATACTATTGTTTGCAAAC
TAAGCGTTTGTAAGCGACAATTTCCAGCTGGTTGTTGCCT