Description :
From Genome Similarity Track
Location :
scaffold_6:57976- 59909
Transcript NameFunction/comments
g392.t1hypothetical protein

Sequence
1933 bases(100 bases per row)
ATTTGCACGAACCTGCGATTCTGCAAGTGTTGAGACGACGATTTTTCCATGGAGAGATCTATACGAGCACAGGGCAGATCTTGGTGGCGATGAATCCATT
CAGAAGACTGTCGTTGTATTCGGACGACATCAAGGACCGGTACTACGATCTCGGAGGTAACGCCGAAGCGGACAAGAGCATTCTAGCCCCGCACGTGTAT
TCAGTCGCGGACCAAGCATTCCGTACAATGTTGGTGCCTCGATCAGGCGACAAGAAGACGGATCAAACCATTCTTGTGAGCGGAGAGAGTGGCGCTGGTA
AGACGGAAACCACCAAGCTCATCATGAACTACCTGGCCTATGTGTCGACCAAACGTACGCGACGTCCAATTCGAGCAAGCAATTGCGACCAGACGACCAT
TCACGACCGAGTGTTGGAATCAAATCCGATTCTGGAGGCGTTCGGCAATGCAAGGACAACGAGGAATAACAACTCCAGCCGTTTCGGTAAGTTCATTAAG
CTCGGGTTTACTTCCTCGGGCGAGATGCTGGGCGCCTCCATCTCCACGTACCTGTTAGAGCGTGTCCGTCTCGTGTCGCAGGGCAAGGGAGAGCGCAACT
ACCATATTTTCTACGAAATGTGTGGCGGCAGTTCCTCATCCGAACGTCAGGAACTGGCACTGCGGGATATCCACGATTACGCGTATTTAAACCAGTCGGA
ATGCTATGAGCGTCTGGACGGAGTGGACGATGCTGAATCTTATCAGGTGACGCGACGAGCTATGTCAAGCATTGGGATGAGTCCTGATGAGCAGCTCAAT
GTCATGAAGATCGTCTCGGCCGTACTGCATTTGGGCAATGTTAGCTTTACGACAGCTACGCGCAATGGTGGAAAGGATGATGCGTCTGTGGTAGATATGG
ACGAATGTGGCGAAAACATTCAGGCGATTTGTTTACTTCTGGGTGTGGAAGAAGACGTGTTGCGCAGTACACTGTGCACAAAGCAAATTAAGGCTGGCGC
GGAGTCCATTACGACTCGCCTTCCGGTTGCACAGGCACTTTCGACGCGGGACTCAGTGGTCAAGACCCTTTACTCCAACCTATTTAACTGGCTTGTGGAC
CGCATCAATCGAAGTATCGAGTACAAGGAGGAAGCGGGAGGCAGCCAGTTCATTGGTGTTGTTGATATTTTCGGTTTTGAGATTTTCGAGCAAAACCGAC
TGGAGCAGTTGTGTATCAACTACGCCAACGAGAAACTGCAGCAGTTGTTCGGCAGATTTGTGTTCCGAATGGAGCAAGACCAGTACGTTGCTGAGGAGAT
CCCTTGGAAGTTCGTGGATTACCCCAACAACGACGTGTGTGTCGCGCTGGTGGAGAAGCGACACATGGGTGTATTTTCTCTTTTGGACGAGCAGTGTTTG
ATTCCTCGCGGCAACGACGAGAAATTGGCAAACAAGTACTACGAGTGCCTAGCAGGCAAGCACGAAAGCTTTTCCGTGTCTAAACTTCAGCGTGCCAAGG
GTCAATTTGTGATTCACCACTATGCCGGTGATGTCTGCTACATGACGGATGGTTTTTGTGAAAAGAACAAGGACCACATGCACACAGAGGCGGTGGATTT
GCTGCGCACGTCCAAATTCGCGTTTGTGCGTGCGTGCTTCGAGAACAGTGTCAACTCTGGCAGCGCTAGCCCAAGGAACGGTCGAACTGAATCTCGCGGC
AGTGATGGCCGTCGCCGATCTGGTGGCATCATGTCGTCCACGGTCGTAGCACAGTTCAAGAGCCAGCTGAGTTCGCTTTTGGATGTGCTAAATGCAACGG
AGCCCCATTTCATTCGGTGTATTAAACCAAACGACCAGGCAAGCGCGTCGCAGTTCGAGCGAAGGCGTCTCCTGGAGCAGCTACGCTGCAGTGGAGTGCT
GGAAGCAGTCAAGATTTCTCGCAGTGGCTACCC