Description :
From Genome Similarity Track
Location :
scaffold_6:57967- 84934
Transcript NameFunction/comments
g392.t1hypothetical protein
g393.t1 nucleoredoxin, putative
g394.t1 conserved hypothetical protein
g395.t1 hypothetical protein PHYSODRAFT_333950
g396.t1 mediator of RNA polymerase II transcription subunit 31
g397.t1 hypothetical protein PHYSODRAFT_561460
g398.t1 ubiquitin-conjugating enzyme E2, putative
g399.t1 hypothetical protein PHYSODRAFT_509106
g400.t1hypothetical protein

Sequence
26967 bases(100 bases per row)
AGCTCGTGCATTTGCACGAACCTGCGATTCTGCAAGTGTTGAGACGACGATTTTTCCATGGAGAGATCTATACGAGCACAGGGCAGATCTTGGTGGCGAT
GAATCCATTCAGAAGACTGTCGTTGTATTCGGACGACATCAAGGACCGGTACTACGATCTCGGAGGTAACGCCGAAGCGGACAAGAGCATTCTAGCCCCG
CACGTGTATTCAGTCGCGGACCAAGCATTCCGTACAATGTTGGTGCCTCGATCAGGCGACAAGAAGACGGATCAAACCATTCTTGTGAGCGGAGAGAGTG
GCGCTGGTAAGACGGAAACCACCAAGCTCATCATGAACTACCTGGCCTATGTGTCGACCAAACGTACGCGACGTCCAATTCGAGCAAGCAATTGCGACCA
GACGACCATTCACGACCGAGTGTTGGAATCAAATCCGATTCTGGAGGCGTTCGGCAATGCAAGGACAACGAGGAATAACAACTCCAGCCGTTTCGGTAAG
TTCATTAAGCTCGGGTTTACTTCCTCGGGCGAGATGCTGGGCGCCTCCATCTCCACGTACCTGTTAGAGCGTGTCCGTCTCGTGTCGCAGGGCAAGGGAG
AGCGCAACTACCATATTTTCTACGAAATGTGTGGCGGCAGTTCCTCATCCGAACGTCAGGAACTGGCACTGCGGGATATCCACGATTACGCGTATTTAAA
CCAGTCGGAATGCTATGAGCGTCTGGACGGAGTGGACGATGCTGAATCTTATCAGGTGACGCGACGAGCTATGTCAAGCATTGGGATGAGTCCTGATGAG
CAGCTCAATGTCATGAAGATCGTCTCGGCCGTACTGCATTTGGGCAATGTTAGCTTTACGACAGCTACGCGCAATGGTGGAAAGGATGATGCGTCTGTGG
TAGATATGGACGAATGTGGCGAAAACATTCAGGCGATTTGTTTACTTCTGGGTGTGGAAGAAGACGTGTTGCGCAGTACACTGTGCACAAAGCAAATTAA
GGCTGGCGCGGAGTCCATTACGACTCGCCTTCCGGTTGCACAGGCACTTTCGACGCGGGACTCAGTGGTCAAGACCCTTTACTCCAACCTATTTAACTGG
CTTGTGGACCGCATCAATCGAAGTATCGAGTACAAGGAGGAAGCGGGAGGCAGCCAGTTCATTGGTGTTGTTGATATTTTCGGTTTTGAGATTTTCGAGC
AAAACCGACTGGAGCAGTTGTGTATCAACTACGCCAACGAGAAACTGCAGCAGTTGTTCGGCAGATTTGTGTTCCGAATGGAGCAAGACCAGTACGTTGC
TGAGGAGATCCCTTGGAAGTTCGTGGATTACCCCAACAACGACGTGTGTGTCGCGCTGGTGGAGAAGCGACACATGGGTGTATTTTCTCTTTTGGACGAG
CAGTGTTTGATTCCTCGCGGCAACGACGAGAAATTGGCAAACAAGTACTACGAGTGCCTAGCAGGCAAGCACGAAAGCTTTTCCGTGTCTAAACTTCAGC
GTGCCAAGGGTCAATTTGTGATTCACCACTATGCCGGTGATGTCTGCTACATGACGGATGGTTTTTGTGAAAAGAACAAGGACCACATGCACACAGAGGC
GGTGGATTTGCTGCGCACGTCCAAATTCGCGTTTGTGCGTGCGTGCTTCGAGAACAGTGTCAACTCTGGCAGCGCTAGCCCAAGGAACGGTCGAACTGAA
TCTCGCGGCAGTGATGGCCGTCGCCGATCTGGTGGCATCATGTCGTCCACGGTCGTAGCACAGTTCAAGAGCCAGCTGAGTTCGCTTTTGGATGTGCTAA
ATGCAACGGAGCCCCATTTCATTCGGTGTATTAAACCAAACGACCAGGCAAGCGCGTCGCAGTTCGAGCGAAGGCGTCTCCTGGAGCAGCTACGCTGCAG
TGGAGTGCTGGAAGCAGTCAAGATTTCTCGCAGTGGCTACCCCGTGCGGTTTCCTCACGATGTATTTATCAAAACGTACAGCTGCATCTTGTCTCAGGTT
CCAACTGCACAGGGGCAAGAGGAGAAGGAAGTGGCAAGTCGTATGATAGAAAAATTGGGGACCATGCTCGAATTCGAAACGGATGCGAAACACCCTCCGT
TCCAAGTTGGCAAGACTAAAGTGTTTTGCATTCTCGAAGCTCATCAAGCTCTGGAAGCGGCTCGGTCGAAGGCTCTGTACAAGTCGGTGATTACGTTACA
ACGATATTGCCTGGGTTACTCTGTGCGTACTCGGTATCAGCGAAAGCGTCGATCCAGTATTCGTATTCAAGCTATCTGGCGCTCATGGTCGTGCTGGCAC
CGTTACCAGCGAATTGTTCGTCGGCAGCGGGCAGCTATTACACTTCAGCGCACAACTCGTGGGTTCCTGACCAGGAAGCAGTTGAAACGTGTTCATGCAG
CGACTGTTATCCAGTCTTTCGTGCGTGGATGGCTTGTTCGACGCGAGTATTCCGCGAACACGCTGAGTTTCGAGCATGACGTGTCGTACGTGGGCTCCCT
AGATGAGCGCAGTACCACAGCAAGTTCTATTTCCCTTTCAGAGTCGCTTTCAAAGGACCGGAAGAACACAACCATCTCGTTCCAGAGCTCCGTCTCCACC
AGTGACTACTCTGATACTGACGGAAGTATCAGCATCCGAAGTAGCTCTCGCGCTTCAAGGAAGAAAATGATTGAGGAGTATGAGCCGCCCAAGCATGTCC
AAAACGAGTACGAGATCGTGTGGGAGTGTGGACTACTTGGCTTGTATTTTGAAAGTGACCCGGTTTCCGGCATGCCTATTGTGCGTCGTGTTCACGAGAG
CTTGAGCAACTGCGCAGACATCTTCGAAGTTTCTCGTGGTGACGTTCTCCTCGCTGTGGGCAAGGTTAAGGTAAAGAAGGGGGATATTCGTCGTATTCTA
ACTTTGCTGCAAGAGGTTCAGAAGCCGGTGCGTTTGCACTTCCTCCGCAATCCGACCGAGTCGTTCCGCCTCCGGTCAGGATCGCTTGAGCTTCTGGGTG
AAGAGGACTACGAGGTGCTGTGGAAGGAAGGCGTGCCTCTTGGTCTTGGGTTCCGTCCAGACCCGAGCACTGGGTACCCGTGCGTTCTCCAGTCTCAAGG
CAACCAACTTTTGCCTGGCATGTTCAATGTGCGAGCAGGCGACCACCTGGTCTTCATCAACGAGTTCTCGACGCAGGGTGTGCGCTTCCAGAAGGTTATC
GACATCTTGGAAAGCGGACCTCGACCGGCAGTGCTTCGCTTCCGCCACACTGATTTCGTGGAAGACCCGCACCACCAGCTGGACCAGACCAATCCACTGA
ACAGCTCGGTGTTGTCAAACCCGCAAGATGATTCTACTTCGATGGGGATGTCTCGCATGACGCGTGCATCCCGTGTGAGCATGAACCCGAAGAACGATCA
CTCGCTGTACTACATCACGTGGAAAGAGGAGGACGGTCCCTTGGGCATTGTTGTCAAGCAGGAGAGCACGAGCTACTACCCGCGTGTGATTAATGTGAAA
AGCGAGGGTGCTGTTACGCGTGAGTCGCAAAAGAACCGCGTGGAGATTGGCGATGTTCTGCTGAGTATCAACAACAACAACATCAGCAAGATGGGCTTTG
GCGCAGCGATGAAGCTGTTGCAGAAGGGCCCCAAGCCGCTGCTGTTGATGTTCCAACGCCCGCGCAACTCCTTGTCAATGACAACAAGGAGTTGTAACCT
GTAGTCCTCCGTCTTCCCCGTTGGTGTTAAATATTCCAGTTTTGAGCCGCACGGACAGCATGTGATGGTGGCAAAGCGCGAATCCCACGGCTCGAGATGG
TCATATCTGCAGACGAGGATGCAGTTTGGTAAGGAGAGGCTCACGCGTCGAGATCTTCACCCCGTACGACCCACCTAGTGGGGCTTTTCCATTGCGGTCG
TTCGTCAGCCACGTCCGCGCTGAAAGTATTTTGAATATTGGTTTTGTTATAAAGAGAAGTTGCGCTTTCATGTTCACGAGTGTGTTCCGTTCTTCATCCT
TCGTCTCTTTACCAAGTTGTAAAGTGCTTCAAAAGTAGGTCAATCTTCAGTATTTCACTAAGAGCGAGAAAATCTATCTGGGAAACAAGAAGTGTAGATT
GCAAAAGTGGAATTGAATTCACATTTATCTGCTAAAAATTCTAAGAAAAGAAGAGCAACAAGACTTCGAAGGTCCTGAACGGTCTAATCCTTCTTCTCTT
GACGGAGGTGAGCGAGGATGGCATCAATATCGTCAGAGTGGTCCGTGATAAAGTAGCGCCCCTCGCGCTCGATCATCTCGCCCTTCTCGTTGAAGAAGAT
GAGCGTGGGGACAGTCTTGACGCCGAACTTCGCGCACAGCTCGAGCTTGAGATCACGACGGGCGTAGGGCAGTGCGATCCACGACATCTCCTCGTAGTAC
TCGGTGAACTTGGCCTCCTCCTTGTCCGAGGACACGAAGACGATCTCGAAGTCCTCGTGGCCAGCCTCCTTGATGTCGTTGTAGACCACGTCCAGCAGAG
GCGTGAACTTGCGGCATGGCGGACAGTAGTGGCCGCTAAAGTAGAGACCGATGACCTTCTTGCCGGCCAGCGCCTGAGACGTGGGCACCACCTCGCCGCT
CTTGAGCAGCAGCTCGTTCTGCAAAAGGGCCTCCATTGCTGTGTGGGGTCAAATATGCGAGTGCACTTGGACGAGGATGTAGGAATGAGGAGACGACTGG
CAGCTTTTGAGCAGGGGAAGAGCTACGATTTTGGCGGGACTCTCGGTGATTGGACAAATTACGTGACTGGCACAATGAAGAGGCTTGATTGGCTGAGAAG
GATCGACGATGACGCGATATGGCTACATTCGTCTACGAAAGCAGAATCAGAACCCGAATTCGAGTGATAAGTTGTCGGATAACAAGCACTGACATCGTGA
TAACCATCGATTGTTTCCTTGCAAGCTACTCCTGCAAGTTATTTCCCTTCCTAAACGCGACTAAAAACTCGTGAAAAAGTTGAGCTGCTGCATCTTGTTT
TCTGCTGTCTTCTTCTCCCCCTGTCTCCGTCTCTCTCGTTGCTCTTTGCTCACGGTTCCGTTGCCATCTCATAGCGATAGGCTGCAGTCGAGAAGCACGA
CGCTATTTAGCAGTAGAAAAACCCGCCATACGGGCGTCCGAAAAAGCAGTTCGAGCCGTAGATCGAGCGCCCGAACGTGTTCCAGTAGCCAATCGGGTAG
CGCCAGCCGTAGCGGAATCCTCCAGCCCAAGGATACGTGTAGCGCCAGCGGTACGTGATTCCTCCGGTCGGGATGAAGCCACCTCCACCTCCGATGAATT
GCTCCAACTGCTCCTTGTTGGCAGGCACAGGCTCTCGGTCTCCAAGAACTGTCACGCCGGGCGGGGTCTGCTCCGTTGGCGGGCGCTCTTTTTCAGCCGG
GGCTGCAGGAGTTTCATCGGCGTGAGCACAGCTCAGCATAGCGACCAGGACCACCAACAGAAGGACGGCAACACGTTTGATCATAGTGACTGAAGTTAGT
CAAGTGTCGGGATTCTTGGACGAGTGTTCACGACAGCGTAAAAAGCCGAATGGCAAACACACCGGGCTGCGGTCGATGCAGTTGGAGAAAAGTCTGCGCT
CAGGTTCAGCTCGTTGCGGTTTACAATGCCTGGGACTTGCAACGAAAGCTCGTGGCGGTGTTTTATTGCTTAGATTCACTCGCTCGGATGTTCCGTTGAA
AGTCCTATCTGGACTTCTCACTCGTCCCATACACGCACGACACCGGTACGTGTTTCCCCGATATTTGTTCGGAACGCAAAAGCTTGGGCGAAAATCGGCA
TGACATCAGTGTGAATATTCAACCTTTTGCTTTCGCAGGGGTGATCTTGGCTGGTGCTGAGTGCAGACTTCAAATCTGTAGGCCATTCATTTGGCAGGAG
TTCGATTCTCCCTCGCTTGCGCCTTTTTCCTAAAACATCTAAACTTTGTATCAACTTGTTGAGATGTTTTAGGAAGGATACTATCAACGAAAATGCCAAA
CCGTCGTACATGTACTTACATGAACTTGTACGTGTAACTTGTTGCAGCCAAACCTGCTAAAGACTTTACTCGACCCGAGATCTTCGTTTGCTGCGCGCTT
CTTCAATGATGAGAGTTCGTGTAATCAACGGCTGCATCCAAGCCACCGCCGAAGCCGTTCCCTTGGCGAGCTGTCATTGGCCAGCCACCACGTCACATAG
GCCGCAACACGGCGTCCACCGACTTGCGCCGACGTGCATCAAACGGACGGCGACGCAGTTTTCAACAGGCTCGCGAGCGACTAGCAAGACCCGCCACTTC
CCCCTTCCCACCTCTGCCAAGATGCCGCGCCAGCTCAAGACCGAGCAGTTGCTCCAGCCCGTGCCGTCCGACATCGCGATCAGTGATGCCATCGCGCCGT
TGGCCATCACGGAAATCGCCCAGGCCGCCGGAATCGTAAGATACTTTCGGTCGTAACGGAGACTTTGTCGGTATTAACAATTCGTCGTGCTATTGCTGCT
GTAGCTGCCCGAGGAGGTGGTGCCGTACGGATCGACGAAGGCCAAGATCTCCCTGGACGTACGTGAACGTCTGAAAGACCAGCCCAACGGCAATTACGTT
GTGGTAACGGGAATCACGCCTACGCCTCTGGGAGAAGGCAAGAGCACCACAACGATCGGGTAAGTGTGGACGCAGGGATGGTGTCAAGCTTAGGAGCTAA
TGAAGATGTGGATGTTTTTGATTCGACCAGACTGTGCCAGGCGCTGGGTGCTCACCTCGACAAGAAGGCGTTTGCTTGCATCCGCCAGCCATCGCAAGGA
CCCACGTTTGGTGTCAAGGGCGGTGCTGCTGGTGGAGGCTATGCGCAGGTTATTCCCATGGACGAGTTCAACCTGTACGTGGTATGTGCTGAGCATTAGG
AGGACCTGTGCTGACTCTCCTTGCGCGTATTTTTGCAGTCACCTGACAGGAGATATCCACGCTATCACTGCCGCCAACAACCTGGTGAGTAGTTTGTTTA
ATTGTGGTTGCATTATGACTACGCATTGACTGATCTGCTCTTGTGCTGCTCTTGTAGTTGGCTGCTGCCATTGACACCCGAATGTTCCATGAGAACGCGC
AGTCGGACAAGGCACTTTTCCGTCGTCTGTGTCCGGCGGCCAAGGACGGGTCCCGTAAGTTCTCTCCTGTCATGCTCAAGCGGCTGCAGAAGCTGGGAAT
CACCAAGCTGTCGCCCAACGACCTAACTGATGAAGAGATCCACAAATTCGCGCGTCTGGACATCGACCCGGACACGATCACGTGGCAGCGGGTGCTCGAC
ACGTGCGACCGATTCCTGCGTCAAGTGGTCGTGGGTGCTGGCCTCGCCGAAAAGGGTCAAACCCGTAAGACTGGCTTCGACATTACAGTGGCGAGCGAGA
TCATGGCCATCTTGGCGCTTACGACGAGCTTGGCCGACATGCGCGAGCGTCTTGGACGCATCGTCATCGGCATGAGCCGCGATGGTGAGCCTGTGACGGC
TGATGACCTGGGAGTTGGCGGCGCTTTGGCTGTGCTTATGAAGGATGCGATCCTGCCCACACTCATGCAGACAGTGGAAGGAACCCCCGTCTTCGTGCAC
GCTGGTCCGTTCGCCAACATCGCGCACGGTAACTCGTCTATTATCGCCGACCAGATTGCTCTCAAGCTCGCGGGTGAAGATGGATTCGTCGTCACTGAGT
GTGGATTCGGTGCCGACATTGGCATGGAGAAGTTCTTCAACATTAAGTGCCGTACTAGCGGCCTCACCCCGCAGTGCGTGGTTCTCGTTTCCACGATCCG
TGCACTGAAGATGCACGGTGGTGGCCCCAATGTGGTAGCTGGCAAGCCGGTAAGAATTGTTGTGTCGCAGTATTTACCATCGTTTATTCACGAATTGTTT
GTAATTCTTTGCCTTACAGCTTGATCCCGTGTACGTCGAGGAAAACCTCGAAATGCTGGAGCGTGGGTGCGCCAATATGCAGCACCACATTCGCAACGCG
CTGAAGTTCGGCGTGGCGGTTGTTGTTGCTGTCAACGTCTTCGCACAGGACACCCCTCGTGAGGTGGAACTCGTGAAGCAGAAAGCGATGGAGGCTGGTG
CCACTGCTGCCGTGGAGAGCAACCACTGGGCCGAGGGTGGCAAGGGAGCCAAGGAACTGGGTCGCGCTGTCATTACTTCCTGCGACACGATGCGTGCACA
GGGCAGCCCGTTCAAGTTCCTGTATCCGCTCGAGTTCAGCATTGCCGAAAAGTTCGAAGTTATCTGCAGTACGTTCCCCTGTTTTTTGTTTCTTTGTTCT
GTTGGACACATCGCTAACTTCACGTTCTCTGCGACGAACAGAGGAAATCTACGGTGCTGATGGTGCTGAGTTCAGCGAAGAGGCAAAGAAGAAGTTGGCG
GTTTACTCGCAGCGGGGATACGGCAATCTCCCTGTGTGCTGCGCGAAAACTCACTTGAGTCTGAGCACGGATCCAACCGCGAAGGGTGTGCCCACGGGCT
TCTCAGTCACAGTGCGTGATATTCGCGCGTCTGTCGGCGCAGGATTTGTTTACCTGCTCTGTGGAGACATGATGACGGTTCCTGGCCTTCCGACGCGCCC
GGGCTTCTACGACGTCGATCTGGACACTGAGACGGGCAAGGTGATCGGTCTGTTCTAAGCACTTCCAGTCATAGCGAACTACGTTCGACGGCAAGCAAAG
GGCGGCATGTCGTATAGTTCACGCCCCCCTCTCCTCCCCGTCCACCGCATCTGCTTCTGTAGTTAGAGACAAACAAACCTGTTTAGCCATCCACTTTGCT
TGAGTCCGTGAAATTGCATACATGTATATTGTATCGGCTCCAACAACCAGGTCTAACTGCTCTCAGTTGAAGCAGCAGCTGCCGGTGTCTCGGCCGTCGG
CGCCTCTGGAGGCTTCCCCTCGGACCTGTTGTTGAGGAAAGTCTGCCAATGGTAGAACTGCTGGCCGTGTACGAGCGTCATGAAGTCCTCGCGCGCAATC
ATCTGGCGGAATCTCTCGTCGTCCAGCATATCCAGGAAGGCCAGACAGTGCGGGTACACGATGTACTTGGCGTACTGCGGTTGCTTCCAGTACTTGAGAT
ACTGCAGGTAGTTCATGAAGGCGGGGTTCTCGAAGTACCGGTTGATGGCAAGGACTGGTCGCACAGGAGGAGGTTAAAGCCTGGAGGGAGAGGACGGAGA
AGGATATACGCACGTACAGTTGAGGTAGGCGGGGCTAGCGAGGCACTGGATGAACTCCAGCTCCATTTGAAAGCGAATATCGTTAGACGGCACCTCCACC
TGGGCGCTCATGGTGCTCTGGCTGAAGTGACTTTGCAAAGTTTTCAAGTTTACGAACAACATTCGAGCAACATTACCGCAATGCAACAAAAGGAACGTGC
AGACTGCAAGTTACAGTGTTGTGCTCACTTATAGACGTGCATGTACATGTACATGCTGCATTTTGACGAAGTATTGCTATCTACTTCGAAGTATTTCGTA
TTATTCATTGCCACCACACATGCATTATAGTTACTGACTTTAGATTACGAAAATTATGATGAATGCTGTTGCTGTGGATGACTATTTCCACTGTAAAACT
TCAGATGACGAGCCTGGAGCGGAGGCTGGAGCCATTGGATGCTATGGAACCGAGTTTGTCGCTGAGGGGGTGATTGGCTCTGCTGGGAACAGAGCGTGAG
CCTCATCGTCGTCGAACATTTCGCTAGACCAATCAGCTTCAAACGCCAAATTGGACAAAGACGCCTTGAGATCTTCTTCTCGAGTGACCTCTTCGGTTCC
GATGTCGTCATGGCTATGAGTCATCGCAAAATTGGGATGGCGGTGCTTCAGCTCCAACGGTACGATGGAGGTGAAGCTTATGGGGGACATACAGCTATTT
TCAAATTCCATGAACATCAAGTCGTCGTCATCATCCATCGGATCAACCGAAAGCGAGGCGATACCTGCTCCAAGCATCGACATGTGACTCTCCGGTGGGG
GATTCCTCATCATGGAGCTAAACTCGTCCTCAGACAGTACAAAACTGGACGAGTCAGCGAATTGGCTGAGCGGGTTACTGAGAGAGCTGATGGTGTCGAT
ACAGCGCATCATACGCAGCGTGAGCGGGATCGTTGAAAGATGTATCCACAGCTGCGTGCTTGGGTTGCTCGACAGCCTCACCACAATTCTCATTTGCTGA
GACGGGGAAAACATGACTCCATCGCCGCGTTGTTGCTGCGCTCGAAGAAAGTCCTCGAGTTTCTCTGCATCTCCGAGCGTCAGATACTGGAGCAAGTTGG
CACCGTACAGGTCTGCGGCGTTGTCGGCCCCGAACTCGGATGCGCATGTGTCTGCCACGAAAATGAATGCACCCGACGGGAGGCAGTAGGCGATGCGTTT
GCCGGTTGGCACCTGGTTAATCTCCAGCAATGTGACGGTGCCCAGCCCCATAATGACTGCAGTTAAGTGACTTCGTTCTTGTGGTGCTACAAGGCACTTT
AAAAGTGACGACAGTCGGCTGTCGTCTACGGTATGATCGTTTCGGGGTAGACGGCGAGTGTGTAACAGGAAAGTGACCGAGTGAGTGGAGCGGTCTGTCG
GTCGAACTTATAAGAACCGGCAGAGAGAACTGATTGACAGACAGCTCAGACTAATGATAGCTTCTAGACGCACGGACGTACTGGCGTGTGGGCCTGGCAC
CCCAAAAGCAGATCGCACAATGGTGCAGTTGGTTCCGCGTGGGTTGGGCGATGAGAGCGAGGAGGACGATCGGGCTGCGGGTTGTTGCTAGCTGGCTGGA
AAACCCGTTGGAGGGTTGGTTTGGTGGTTGGCGTGGCTCGGCTTCACTTGCACCCGTTACCTGCTGTCTGTTTGGTCAAGCTGCCGATGCAACAATGGCA
AAGTTGATGGAACCAGCGCGGATTGCAAGCGGTGCCAATCCGACGACGCGAAAGACGAACAAGATTTTAATGGTGTCGAAAACCCGTCATTAGTGATCTC
AGCAGGGATGGAGGGTTATATTTTCTGGAGGATATTATTCTCCTCTTTAACTGTTTTTTAGAACAGGCGACTACAAACGGACTTGACGGGTCTGAAAAGG
ATTGCAGGATTGCAGGTTCCTCGTTGAACTTGCACTTCAACCTTGCCCTAACCAGGACTGACGTGCTTTTGGTACAGTGTACCCTTCAACTCGCCAGCTA
TTGGCTGAAAAGGCGTGACCAGCCAATACAGTATTGTCGAAGCGGTGCAACGTCGATGTCATCGGACGAGGAAGCTCCGACGCCGCTCGACGACTGCGAA
TATCCCGTGGTGCTAGGGCAGTCGCTCCTTGACACAGAAGGGAATGAGGATGAGCAACAACAGAGCAGCGTGTTCACGTCCTTCGGCTACGAGTTTCAGC
CCGCGTCCGTGGAAAAGAGCACGCCAGGACTGGTGTGTGTGGACGGATCCAACGGTGTGCAGGTGCTCATGGGCTCGTCCACAGGTGCGCCTGGTGGCGT
GAGCTTCAAAGGGAAGATCGTGGAGCACAAGGAGACGGATTGCCTGCTGATCTTCGACGGCTCCAGCTTCCGCTTGGAGCGCTGCCCGTTCTCCTGTATG
CAGCTGCGCCACGTGCGTGCTCCGACGCCGCGGCGCTGTATGAAGATCCAATCCAAGCAAGTGAGCAGTATAGAAGCAGAGCCGGTGTCTAATAAGGAGG
TGGGTGGGTCCGTATCAGCGACGGTAGCATCAACCAAGATCGGAAAGAAACCAATAGGCAGGCCGAAAGGATCTCGAAACAAAAAGCCGAGAGGGTTGGC
CAAGACTGCTCCGACTGTAAAGCGACCTAGAGGACGGCCGAAAGGGTCGACAAATGCAGTTATTGCAGCTAAGAAAGCGCGTCTGGAAGCTGAGGCCAAA
GTGAATACCGAGACATGAGCTGCGTCTGTGGCACAGTGTGGAACAATAGGCGTTGCGTCGCGTCAATGCCATGCTTCAGTTCGACAATCATTCGATTCAC
CTATGACTTCATAAAGTATATTGCTACGTATGCCATGTCTATGGAACTTCCATCGGAAAGCGTCGTCACTTGTCGGGTTGCTTGACCAGCTAGCTTACAA
TGATTCCTATGTTTCTGGTCGAAGCGAATCTCGTTATGTACAACACACCAAATGTTTGTGAAAAGACACATGAAATCTGAGAATAACAATGGGGTCTCTG
CCCAATACAAAGGCCAAGTTTAAAAAGGTAGGTCAAACGTCTAGTGTGAGGGCATTAGGTTTTCTCTCAAAGTGAAGAACACCAGCTGGCAGGAAGAACA
GACGAGTCCCAGCGGTTGCGAGAAGGAAGCGAAGCCCCAGAGCCGTCTAGACCAGCCCCATCCAGCATGAACAAAGCCAACAAACGCCGCGAGACGGACG
TCATGAAGCTGTGCGTGCCGTTCGCTCCGTTAAAGTTTAGGTGGAAGATGTCAGAACATTCGCACTAATTGGTGCTACACTTTGTGTTGCGCAGCATGAT
GAGCGACTACGAGGTGGTTCTGACTGACGAGACCAAGACCAACGACCTTGACATCAAGTTCCACGGCCCAAAAGACAGTGCGTGTGCTTTAGACTGAAAG
CGCAGAGGGACTATTCCTTCTGACGATGCTTCTGTGTCGTTGTGTGTGAGAAGCCCCGTACGAAGGAGGCTCCTGGAAGATCCACGTGACACTGCCTAAG
GACTACCCGTTCAAGTCTCCCTCGATCGGCTTTGTGAACCGCATTTACCACCCCAATGTGGACGAAACGTGCGATATCCGGGAGATCGGGCAGGAATGTA
ACAGACTAACAATTATTGTGGTGCTGATGTTGTATTGAATTCGCTAGATCTGGATCTGTGTGCCTGGACGTGATCAACCAAACGTGGAGCCCAATGTTTG
GTGGGGAACTAAGTGAATTTGATGATTTTGGATGGAAGATGTTAACGTTGCTGTATCTTGTCCCAACAGAGCTGGTCAATATTTTCGACATGTTCATTCC
TCAACTGCTCCGCTACCCAAACCCAAGCGATCCATTGAATGGTGAGGCTGCCTCGCTGCTCATGAAAGACGCCGAGTCGTACAATAGAAAAGTGAAAGGT
GGGCAAAGTTGCTCAGGTATCGAGTTCCAATGCAGCAAACTGACATTTTTTTGGATGATTCATGCAGAGTACGTGCGCAACTACGCTTCGCAGCCTATTG
AGATGGGCAACGAGGAAGAGGACAGCGACGTCAGCGATATGAGCGACATTGAGTAGTGTTTCCTAGCAGGTTCGCTACCGACACTACAGTAGACCGACCG
ATCTGGTGTATTCTGCTGGTATCATGACTCTCACTTGCAACTCCGCTTCCAACGTCAGCCAGATCTTATCATGTCGCCCCACCCATGTCCCCAATGTTTC
ATTTCATTATTCTTCTCGGTATCGTAACAAAAAGAAAGGAATAACACTTCATTTTTTTTAATTTTTGCAGACTTTTGAGTCTGAATCTCTGTGAAAACTT
GTGGGCATCTCCAGAGCTACTTCGAAAGAAAGTTAGAAGCATCCGCTTTCCTCTGGATGTAGTGAGCATTCCTGCGCAGACGATCACTCATGCTGCTCTC
ACCGTCCAAGTACGCCTCCGAGTGCAGTTTCCTAAAATTGCATCGAAAATAGTTAAGAGGAAAGTCAGTATGGACATACAGAATGACCAAGAAATCGATC
GAATAACCAACCTGAGGAATTCGGGATTGCTGCTTGTAACCTCTTTCTCGCGCTTGTCCAGCTCGTCCTTCTTCATCGTCGCATGTTTGGCAACGTATTC
GTCGCGCTGCTTAGCATCTTCGATCATTTGCTGAGCCATCGACTTCTTCTCCTCGTCCGTCAGCTCGCGGGTTTCTTGACGAGACGACTTGCCTAGCTTG
CACCGCCGTTCCGCTTCTTCAAGGCGCTTAGCTTCACGAGCCTTTGCTAAATACTTCGCATTAGGACCCAATGACGATTTATCGACGTCTTTGGATTCCA
CTGCACCCGCTTTACTGATAAGGCCATACTTCCCCTCGGCGTCAAGAGGCTTGCGTCTCGATTCTCGCTCTTTATAATGGAGACCACCATCCCCGCGCCT
GTCAACAAACTCACGCGCTCGTTCACGAGACAAACTGCGGCGGCGGCTACTTTGTTCACGCTGAGTGCTTTCACGTCGGGAAGAGCTGCGGTCATGCTCA
GTATCATGTCTCCGACCTGAACTACGAGAGCGACGCCTGTCTCGACGATCAACTGGACTACGAGAGCGATTTCTCTCTCGATGTTCCTCATGACCCCTTC
GGGGTGACGTTTTACTGTGGCGACCCACAGAGCGATGCGTTGTCGGTCTATCACGTCCAAAGTCATCACGCCCTCGAGGAGATCGGCTACGGCTGCGGCC
TCGTCCTTCTGGACTGCGGCTTCGACTATGGTAGCGACGGCTTTCTTTCGTACCATGCCGACCCATAGGCGAACTCCTTCCACGTCGTCGCTCATCGCCA
TGCTTGTCACGGCTTGAACGATCTGGGCTGCGCTCGCGACGTCCTGAGTGTCGTTCACTGCGTCGTGACCGGCTACGGTTCCGGTCATGACGATGGCGTT
CAGGAACTGGCGACCTTGACCTGCTCTTCGATCTTGAACGGGATTGCACTCTTTCACGACCACGCTCATGTCCATGGTGGTGTTCGGACGGATACTTACT
GTGTCGATGACTAGTCTTCTCCTCCTCTTCATCTCTACTAACGTCACTCCTGTCACTCTCATCGTGCACCTTCCTCTTTAGTCGTCGCTTCTCCTCTCTA
CGTGCGTGCTTTTTCTCCTTCTTGGCAGTCTTATTGGCTTTCTTCCGAGCTTTCTTATCTTCCTTTAGGCGATCCACCTCGTCTTTAATCCTCTTCATCT
TGACTGGATTCTTGAGAACCTGTTCTCGAGCGGCTTGTTGCCTCTTCCGGATGAGCATCATCGGGTCCTCGTTCAGCCGCTGGAAGGCGTCATTGGCTGG
TAGTGCGCTTTTGCTCAGAGCCAATGAGCCGTACTTCGTAGTGGAGCTCAAATCCACGTCCTCTTTGGCCGCCTTCTCGTCCTCGCCTTTGTATTCTTTT
CCCAACAAATATTCCTCCGCCGTCTTCTCCCTAGCGGCCGATGGCCCTTCATACATCCAGTCGACGCGTTCCACAGCCGCCGACTTGTCACCCCGAGCTG
CTTGTAGCTGCCTCAGCTCCTGCAGCTGGCGCTCCTCCTCGATATTCTTGCGCAACTCCGCGACCTTCTTCTCCTCGGCTGCATGCTTCTGTTCGGCGAT
CCAGACCTTCTCCACATTCTTTGAAAGAGTAAAAGTTAGCTGGTGAATAAGAACACGATGCAGGTGATGAGCAGGAGCAGCTCTACGTACACGTAGGTTG
GCTGTATGCCAGCTCTTCTTGGACAGGAACGCTAACGACATTTTCCCTGGATGCTCCAACTGAAGCAAGAAAATAAAATCGTACTTAAAATAATTATAAT
GTGGACTACATATGTTGTAATTCGTGGTAGTATTTATTTTAATATTAAAATACAACAGATTGCTGAAATTGCATCATTTCAGGTTTACACGATCATGGAA
GGTCGCGGACATCAAGATGCCGACGGTGTGCGTCGTTCTGGTACATTCTCGGGGAGGCAAGTGCCTCTGGAGATGGGGAAAGTGCGCGTTGGAGGCTCCG
GGAGACCTGTGTCCGCTGTGTTATCCGCTGCAGCCTCAAGACGAGCAAGTGTGAACTCATCACAAGACACCGCAGTCGAGTTATCCACCGCTTTGTCACC
TCGTGTGACCATAGAAGTGAGTTTTTCGGGCTCTAGCATTGGATGATTGTGTTAAATCTAACAAATAATGTTGACTGGCTGTGTCGTGATATGAAGCCTC
ATCCTCGAAGTCCATTCCGACGCAAGGAAGAGCATTTAAAGGTGCGGCACAATTCTATCTGAATTCTTCAGTCATATCAATTCCCATATTTAAATGTGTT
GGTTTGATCTAATACTCATAGTATTTTTTTCCTGTCGTTATATGTATGTAGACTGTTCTGCAAGTAGCACAGGGTTCATCTGGTTCTCGTTTCCGAGTGA
AAAAGGCTACGGGACCTCACTTGAACGCTCGTTCTCCTCTCAAAACAATCCGAGCCATGACCAGCAGTAGCAACAATGATTTTGTTCTAATGAGAAGTTC
TCGAGATGATGCAATGGAAGTATCAAGCTCTGGTGAAGGTCTTGCGAAGGAAAAATCAGAAACGATGTTGGAATTGCGAGAGCAAGTGGCACTGAATACC
AATGAAAACACCAAAAGTAGTGCAGAGGAGCTATCAACTGGAAATCGACCTAATACGTCAGCGCTGGATTTATTACTGACACAGGAACAGCCAGAGGAGA
CCACAAATGTATCGGAGGAGAAAGCTCATCAGTCCAATTCAGAGAATACCTGCCAGTCAGAATTGCCGCGTCGAAGTTCTTTAGTATTGCCAGCCGCAAC
GGGTACCTTTGTGTCGAGTATGCCGTCTCTAACGAAAGTGCGAAGTTCCTTCACAGCTCGAGAGCTGGCATTGTTCACACAGCGGCTGGAGACTTCTGAA
TCCGAGCGAAATGTACAGATACGATACCATGTAGCTTCCCATCCACACTCAATTGCAGCAGCTATGCATTCTCTACCGCACCGGAGCAACCAAGACCAAG
CGAGATCCGAAGAAAGAAGAGCTTCCCACAAACGGGCGCTGTCATCGTCCAAGTCTCAACGAGAGTCCAACAATTTACCAAGTGATAAAGTGGAGTCGAC
CTGGAAACGAGTGGACACGTCTATCGAGCACATTTACGAAGACCCATCGATCGACATGGTCCAGCAGTATCTGCTACACAGCCACCACACAACCAGTGGG
CAGAAGAAACGGAAGATGGTGGAGCGTGAACGTACTCTTGCAGCAGCTTCCGACCTTCGCGAGCATCAGAGCGAGGAACAGCAACGTCAGACGAAACTAC
AACAGCGCAAGCTGCAGCTTCAGAAGATGTCGGAAGCCATCCGGCTGCAAAATCAAAAGTCAGTTCGAGCAAAAGCGGCGCATGCATCCGATTTAAATGA
GCGACGGACGAGATCTACTAGACGAGCTGACAGTGCGCCAACTTTACCGGAACGAAAGCCTCCGGTGCCGCGGTTAAGTCGTCCTGGCACCTCAGCAAAT
ACGCGGAAAAGGAAGCCTAAAACCGAGACGTCTCGTCCTCAAGGTGGTGTAAGTACGTCCATCCTCATGGGGTTAACATCAAATTCGAGCGATACACAAC
AGGGAAATGCGGTAAAAGACGAAGTTGTTGATGAGGAGGTAGCTAGTTCTCCTGCTGAACACGTGGCCGCGAAGAGAAAGCCTGCATCAAGTACTCCGCG
TTCGTCAAAAAGAAAGAAACAGGGAGTTACAGCGGTGCCACCTGAAGCTAAAGCCGCTGTACAAGCTAGGGAAGAGCGTCGGGCAATAGCACGGGAGTAC
ATGCAACTACAGAAGCACAGTCGAAAGGTCTGGAGTGCAAAAGCAAAAGAAAAATCGCAACGGGAGCAAGAAAAGCGACAGCAAAAACTCGAGGTATGAT
GCGATTCACTTGAGTTTAATTCTTGTTGGCTGACAGTGTTCAATGATTACTTGACTGTAGATTTTAGAGGCTACTCGCTTGAAGAAATTGCGTCTTTCGA
GAAAGAGATCAAAGGAACAGAAGAAGTATGAGGTAGATGACCTCGTGGATGAACCTCTAGCGATTGCAGCGGTGAATGTTCCTTTAACTCACGACTCGAT
GATACAAGACATCGACATTCATGGTCCAACGAAACTTGAGCTCCCGTCTGAAGGTGATAAAAGCGATGAGAAGGAGTTGACTCTCGAGGCGTCTGATGAG
AATATTGAAAATAACGGAGATATCGGGAATGTTCGTTCCTCCGAACTCTCTTCGCATCACGAAAGCAGAACGGAGATTTTTTATGATCAGGAGGTGACCC
AAAAGACTGATATTACCGATACTGACGACAGAGTTCGGAAACTGCTTGAGCTGAGAGAAAAGGCAGCAGCGCTTTCATCTCGGTTGAGTGGTTTGCGGAA
CCAAACAAGCGCTTCTGATACCGTGCGGTTACCGTCAACGAACTTGATTGAATCTGATGATGAGTTTCAAGCTCGGGCAAAGAATGCAGGAAAGGGTAAG
GTGCTGGAAGAAGATGCTAAAGATGGCTCTCATGATGGAAGTGGTGAAGATGGGGAGGAGAGTGAAGAAGAAGAAACAGATGATGATGATATGGGAAGTG
AGCGAGGAAACGCACAAATTAGCAACAGCGAGTTTTCTTCGAGTGCCTCCGACGCATCAAAACCCACCCAACAGGAGGGAATAATGGAAAACAACGCAGT
GAGGGAGGAACTTGAGGTGGTTAGTGCGACAGAAGCCCAGCGAGATGTACAACAAACTGAAGTCGATGCTACCGATTCATTCGGAGTCTACGAAGTCGAT
GGAAATGATGAGGATATTGACATCCGATCGATTGGAGTGTACAACATTGGGGCTGTATGGCCGATAGACCAGCAAAATGATACTACAACTACCGGACAAA
CAGAGAGGTCGCCAGTGGATCGTTCCCCGAGCTCGTCTTCATCGGTGTCGCCAGCCCCAGCTTCTCTTAGGAGCTCGCAAAGAGAAAGTTGGCTTGACAA
TGAGGGGAAGGTGGCCAACGAAGAAGCATTTGAACTGGAGTTCTATCAGCAGATGAAGAATAGACTGAAATCTTCTACGTCAATTGATGAGGCGACAGAA
GCAGCGGCAGCTAGAGGAGGAGAAGGTAGAGACGGGATGGACAGTGCCTCAAGCTCAGATTCAGATGGACATTTGGCATCACGAAGGAGACTTTATCCAG
CGGATCGCGCCTACAAGCAGATACGAGAGCCAGCTAGTAAAGCTGGTGACTCAAATGCAGGCTTACTGCGACTCATTCGAGAGACGGACGATTCCTTGAG
CGTTGTCGACCGAGCAGCAAAACGTCTGTACCACCAGCAACTCGAGCGATCAGAACGCAAGAGGGAATTGGAACTACAAGAACGGATGGAAACTGAGAAA
AGGGAGTTACTGGCAAAAGATTTGGCGCTAAAGACTGTCATGGCGTCCATAACGGGCGAGAAATCTGCATGTAGCGACTCGGACGCCTCGGATGTGCAGT
CTAACGCTGAAGAGGACAACGAACTGCAGTCGTCTCAGTACAAGCGTTTGGAGGAGATTATGGACGAAGTGGAAAAGGAACGAGCTCGAGAAAATGAAGC
CACGAGTGAATCCGACCGCGATACGTCTACACGAGATGAAACTGAGCAGTCACCAACGCAGAGTCAAAACGTTAACCCAAGTGAAGGGCTACCTGTATCG
CCTTCCTCTGCTTTTTGGGACCAATTGGTTGCAGAAACCACCGAAAAAGAGGCTGAAGATCCAGATCTAATGACTCAACGAGAATCTCGTCTTCGTGAGG
ATCAGACGTCAGAGAATCCTCCTCGCTTGAACTCACCTAGAACTCTGTCGAGGAGGCTTCTGGCAGCTGTAGACTACCAAGAAACGATCTTTGAGGCGCA
CATGCAACTGGCCATGATGGAACACTCGCACAGGTTGGCGAGGGTGCGAGCTGAGACCATAACTCTCGCTCAGGTCTTTAAAGAAGAGATGGAAAACAAT
TCAACGGCCCAGTTGGAGAAGAAGGTTGACGGTTATATGAACGATGTGATGCAACAACTGGATGCAATTCGACAAGGGGAGGAGCAAGTGCCATACCAAC
AAGCGAGTGCTCCTTCTTCTGCGACTTTGGGCGTTGATACAGTGGCTGCTGGTGAACACGACGGTGGTGAGCAGAGGTCAATTCTGGCCACTTCAGTGGT
CGAAGTGAGTTACGAGTTGGAATATGCCAGTGATGACGATTTTTATGAGGAATCCTTTGAGAAAGAGAGTCAACGGAAGAGTGAGCAGCAATTACCCACT
TCTGATGCGTCTGCCAGGGAGGAATCACGGTCCGAAAGTTTACACAAGAGCGAAAGTAAAAGTGAAATTCAATCCGAGCAAGATGATTTTTATGAAGAAT
CATTTGAAAGGGACAGTCAGTTGCATACTGAGCAGCAGTTGCCCACTTCCGACGCTTCTATTGTCGAGGAATCACGGTCTAAAAGCCTGGCCAAGAGTGA
AATTGAAAGTGAGATTCGGTCTGTAGTATCGGAGCAAGATTGCGAAGAGGATTTCGGAGTATCAGGAGAGAAAAGCGCAGTTGAGGAAGAATCTTACGCT
GAGGAAAGCGCGATGGAGGCTGCAGTTGAATCTGAAGTTGAGGATGAGGTTCCATCGAGCCCAATTGTTGAAAGCAAAACTGATGAGTCGCTATCGGTGA
ATTACGAAGAAGATTTCGAGGCTTCTTCGCCCAAAGGTCGAGCAGTGCCTGATCACTTGAGTCAAGGCACAATCGAAGATGAATTGGAGACGTCAAAAAT
GAGTGAGGACAGTGCCGTGGAATCTGAAGTGGAGGATGAAGTTCCGTCGAGCCCTACTGTCGCAAGCCAAGTAAATGTGTCGATGTCGGCGAATTACGAA
GAGGATTTCGAGGTTTCTTCACCAAAACCTCGGGCAATGTCTGATCGCTTCAGTCAAGACATGGTCGAAGATGAATTTCTGGCGTCAAAAAGTAGCGAAG
CGAGTGCAGCTGAGTCCACAATGGAGGATACATTTCCCTCTAGCCCAACTGTTGAGAGTAAAGCCGATGCGTCGATGTCGATGAATTACGAAGAAGATTT
TGAGGTTTCTTCGCCCAAAGCTCGAGCGACGTCCAATCGCTTAAGCCAAGACACAGTCGAAGATGAATTGGAGGTGTCGAAAAGCAGCGAAGCGAGTGAA
AATAGTGGGGATATCGAGGAAGAGGTCGGTGAAAATGGCAGCGCTAAGGCAGGAGGAGAATCGGCCACTGAACATGTGGAAAGCGACTACTATTCGTCGC
AGTTTGATGACGCTAATGCATTAAGAAGTACGAAGAAATCGGAGCAATTCATCATACAGACACAGGACCAACTGAATCGAGATAAAGTTCCTATATCTGT
GCCGAATGAGCTGAACTTAAGCGGGATTCAGCCCTCTACCACTGTTTCAGCGGCGTATGTTGTTGACCTGGAGCGTCGGAAACAAGCGGAGGAATCTCTA
CTCTCTCTCCGCCTCCAAACTGTCGAACAAAAGTACCAGCGTGAATTGAAGCAGCTGGAAAACACCTTGGCCAGTGGCCAGGACTTGGAGACGCGGAAAG
AGACTTTGATGATGGCAGTTTTGGCAGAAAAAGCCAACATTGACAGCTTGAAGGCAGCGTCGACAGCGCGATACTATCAAGATCTTCATACGTTCCGATC
CCTGTGTTTGGATTGGCCCCATACCATGACACACGAGAGCAAAAGAGGACAACCTCCGTACTTTTCAGGCCAAACTGCAAGTTTCGTACCAGCAGTTGTC
TCTCCAGTGCTTGTCGCTGCCCCAAGTAGCCCCCCTAGGCTCATAGACGATGAGCAAGACACGTCTACCCGTCATGAGTACACGGACGACTTTGGGTCAG
AAAATGGCGATACAGAAGCAATCAAAGAGGAGAGCAACGATAAAAGGGATGAAATTGGCGAGTCACGATCGATTAGTTCGGAGCACTCACAGATTGACGA
CAACGTTCCCGAAGAGGAAGAAGAAGTCTTCGAGCAAGAAAGCGACGGCAAATCAGCTTCGGTGCAAGAAGAAGACGAAGATGATTTTGAGCAAGAAAGT
GAGATCAAATCAGCTCCTGTGCACGAAGAAGAAGACGATATCAAGTCAGCTTCTGTTCAAGAAGAAAAAGAAGATTTTGAACAGAAAAGTGATGGCGAGT
CGGTTTCTGGGCCAGAGGAAGAAGAAGAATATGAAGACGAATTTGTCTCAATGAGTGAAGATGTTTCGGCGCGAAAGATTGTTGCTGATGAAGCTGAGGT
AGCAGAAACTAGCGAAATCAGTGAGCACGAGGCCCACAGTGTTCAGGGTGATAGCGACTACGACGAAGACTTCGCTTCCATCAGTGAGAGCACACCGATC
CTGAGAGCGAGTTCAGCGAACGGCCCCCCTCCTGATAAGGCGGAGGTTGAAGAGCAGGGTGTTGAAGAGGAAAACCTGAGTGACGCTGGCGAAATTTCGA
GTGGAAGCGGCATTGAGATGCAACAGAAATCTCCTACTTCCGAAGAAATTGACAGTGAGGGAATTGCCAAATCGAATCAACAGAAATATTCGGAAGATGA
TTTTGAAATTGGACAGATGGAGCAGTCTGTGCTTCCTCCTGCAGAGCAATCTATGAGCCATCGAATGGGCCAGTCAAGTTCTGAAGATTCCTCAATGACA
AAGCTACTAGTGGCCGAGGTCACTATTCTACAAGAGGCGACAGGTGCAATGAAAAAGTCAGAAACGGACGATAATAAGCTCGCGAAAAAGAAAGCAAAGG
TGGAGGAACTCCTGCGGGTGAAAGAACGGCTTCTTCATCAGCAGACGGAGACATTTCGGCGCGATGAAGAGAAACGACAGGTGGACGTTCTCGCCAAACT
CGCACTTGGAGTAGATGTGGAAGAGAAGTTACGACGTGCTAAGGCCGAAATTTCTCAACAGCTTGCCACTGAATTCGACACTTTGAAGCAGACATATCCG
ATGCTTGAGGTAGCTGCGAGTACAGTGCCGCATACAAACACAGAGACAACGGCGACGCCCTCGGTTATGAATAAATTATTCGGGAAGAGTGTTATTGACA
AAACCACAATCGTTGGAGAAGGATACGAGGAGGAGTATGAAGCCGAATCGTTCGAAGAAGAGCTGAACGACCGTGATGGGAACGAAGCTGGTCTTACTAA
ACAATCATCAGACGTTGCTAGTTATGAGGCTGATGAAGTGGAGGCAGAGGATTCCAATAACGGTGTTGTATCCGACGTTCCTAACGTTAGGTATGAAGTC
GACACTGCTGAAGATGTGGTTACGAGTGTAGTTGATGAAGAAGAGGACAAAAATGAAGAGCAAGAAGCCAGTCAAGCTCCAAGTGACGACTATGAAAATG
AGTACGAGGATGAATCCTTCGACGAAGCTCAGTCTGTTCCCGACTCTGTTCCTGATGGAGATGACGAAGCTTCTGTAGTCGAAGAAGGCGCTTCTGCAGC
GGAAGAACCCTCAGTGGGGGATACTAGGAAAGAGGATGAAGCGCTTGACCAGTCTGGATATCATGACGAAGACGCATATTCAGAAGAAGCTTTCGACAGC
GCGTCAGAAATGTCCACAACAGAGGCTGAAGAGCCCGCAAACACACCCCAGGCGGCAAGTACAAATGAGCCAATAGCAATTGATGCTGCGAATGCTGCCG
AGGAGTCCACTTCAAACAATGAGGAACTTGCAGAAGCGATAGAAACTGTTGAGACGCAGCTGGAGGATCAGGCGGCAAAATCAGCAGAATTTGAGCTCGA
TCATGCATCTGAGTCTGTTCTGAACGAAAGCAAAGTTCTGGCGTCCGTGTCTGCTTCGGTATCGAAGGACGAGATAGATGAATCGCTGACGAAGAGTATT
GAGGAGCGAAACGCGCGACTGCAGGCGTTAAAGCAGAAGGTTGAAGACAGGAAGAGAGAGATCATTGCTGTTCAGAAACAAGTGCGAGTGGAGCGACGTA
GGGAAAAGGTGGTAGCAGAAGAAAAGTCGATATTGGACGAAATGGAGGCCGTCGAGAGACTACTGCATGCTGACGAAGCAGCGTTAGACCTGTGCCAGCA
ACGCAACCGATTGGAGCTGATGCATCTAGAAGCAAGAGAGAGGGAGCTTTCCACTGGCAGGAAAACCAAGCAGAACGTACACGAGCAAGAAAGCGATCTT
TTACACGGGTTTGACTACATTGAAGATGCACAGACGGACGCCAGGCAGCAACGATATCCTGCACCACTATCCAGGGACTACACCAGTAAAAGATTTGACT
TGCTCGACGGATATTCGTACATCGAAGCTGCTGAACCGGTCACATTTGTTCCGGTAATGGACGCTCTAGAACGGATCGCTGAAGCGGGAAAAAGTGATAG
CGAAGAATATGCGTTTTCAGCTCAAGACTCACTTGTACAGGAAGTTGGAAGGCAGTCGCTGTCGTCTTCAGAGCATTTTGGTTGTGTTGAGGAAAGCCTC
TCACTGTCTGCAGACGACATGAAAGCAGATAAACACGAGGTTGACGAGAAAAGCAACTTCGTGGTGGCTGAACAGGAATCTAGCGCTCAGCATATCTCTG
AGTCGGAACTCTCTGATGCATTTACACTTCGACACAACTCGCTGGGTGTGGAGGGTCCGGTAGATTTACTTGCTGGGTACGCATTTGTGGAGCTTGCAGA
ATTTGTTTCGTGCGAGAAGTCCGGACTTCCAAACGCGGGCCTGCTCATAGACTACGACTACGTGGAAATAGTGGAAGCTGTTCCCCAGGAAGAAGAGCTC
CAACGAGAAACAGCTACGGATGCCACTGCTTATGATCATGATGAATTGATATCACCACCAGGAAGAGAGGGTGGGTATGGGGTGCACGAGACTGAGCCGA
AGGCGGAATCTGAACGTGAAGGTGATTTCGTGGTGGTTAGCTCCGCAACTCATGAGGTGAAGTCGTCGGTAACACTTGGAGAGACAGTTATCGATGACGG
CGACACTAGTAACATCGCCGAAAGTGTTGAAGAATCCAGGGAAGATGAAGAATCGAACGCATTAGCTTCAGTTGATGCTGGTACTGGCATAAGTAGTGAC
CTCGTATCACAAGAGGAGGCTCATCAATCCGATGTTACCCGCCACGAAACAGTTGACCGAATTTCTACTCTGTTGTACGCTGATGTATTCCACGAGATGG
AAGAAGGTAAGTTTTTACACGTAACCGCGGGGTGTATATTGGAACTGACCTTTGATGTGTACTCTTAGAAATACTGAGTGCCATTTGCTTAAGCAGACTT
GTCCAACTTCAGCCAGATCCATTTCCAACAATGCAAGGAGAGAGCCCACAGCCGACACCTTTCAGCGATGATATAGGAGAGGGCAGTATTGATTCCCGAT
ACACAGCGGATTGGAGTGTGGAACAATCTTCAGAAAGTGTCCATGTCAGGTCGCCGAAAACGAACGGACCTAGCGGTGAAAATGTTTCTGAGGAGGAGGA
AGAGCTTGCGAGTATCGAAGAGTTAGCCACATATGCTGATTCTTTCGCTGAAGAAAGTTTTCTCCATTCTAAAGACGACCCCGACGTTTTGAGAGCTTCT
TCTGGTGAAAAACGCGAAGAAGAAAGTGTAAAAGATTCGGAGCAAGGAGGTGGCTCGAGTGAGGAGTTTGATAAGCAGGAAACACTTCAGGTTGCATCCA
ATTCCGAGCTCGTAGAAGTACCAACGGAGACGGAAACTGGACCAGACGAAGCGCTGCAAAGTGAACGGGTAGCAGATGCAATATTTGGCGCTGTTTACGA
TGAAGTTTTCAACTCGGAGCTCCAGCTTTGGTCTCGTCAGCCACCACCTGCACTTCTACTTGATGCGTCGGAACGGACTATGAAACGCAGTGCAAAGGCT
GTAGGTACTGCGCCCTCGGCTGCTAAACCAACTCCTGGATCACCGACGCGAACACCACTTCAAAAATCCAGAGCGAGAGATCAAGCTCTGGCCCGGAGGA
TCGTTGATCAGCTTGATATCGTCGACGAAAAGGTACGGCTACAATTCGGTAAATCTGAACTGCTAGTGTTTGTCTAAATTAATTTCTTCGTAACCAGGTT
CGGCTGCCTGAATTCAACGCTTTCAACGTCGAAAGCGACTTCTCCGCCGCTCAAGCTCTCTACGATACGGTCGAAGACCTCGCTCATGATTACTTCAGAG
TGATTCAGCAGTCTTCAGCAAGAATCGACGGTGCTTCAGTACTGGCACTCATCCACCGTAACGTCTACGCCGAAATCGACGAGCTGCTGGCAGTCCGAGC
GCAATCCGAGCACGACTTGGAGCGACAGCTGCAACTGATTTCAGACGAGTCCGGGACCGAACCAGGGCTCAGCAGGGATGTGTTGTTGTCTCACAACTGC
ATGGCGTCCAATGTGAACAGTATCGTGTCTAAGGTCCAGTCCGATCTGAGCAGAACCACCGAGGAGCTCTCGACCGCAGATCTGTCGACTCCACGTGTGC
TGCCTCGTACACCAATCCGTCGCGCCAAAAGTACATCCATTCTCTCCTCACTACAAAATCAACAAGACCAGGAGCTGCAGCAGCGAATCACAGGGATGAT
ACTCAACGACCTGATGCGCGACGCCGGACTGCCTTGAAGTTGTATCAAACGATCACCGAAATTTTGCGTTCTGAAAGTTTATATTTCGACATACTGTCAT
AATCGATATTCAGATTGAGAACCATCAATTTTACAAAAGTGTAGCCATAATTGCTCAATGACGTCTCCTGCGGTGGTGACGGCTCTGCTGCAGTGGCTTG
AGGCTCATGGAGGCGTCGACAGTCTGCTGGACATCCGTTACCTGGGAAAACTCGAGGGTCATGGCGTGTTCGCGAAGCAGGCGCTGAACAGCGGCCAAGT
GACGCTGCGTGTGCCGTTCAAACTCACGATGAACACGGAATCCGCATCCCAATCGGATCTTGCACCCGTGCTGGAGAAATATCAGCAGATTCCAGACGAT
GAGGTTTTGGCGTTGCATTTAATGCACGAGCGAAGTAAAGGCACAGAGTCGTTCTTCGCCCCGTTCATTGCATCCCTGCCCACCACGTTCGACTTGCCGG
TTTTCTGGTCGGAATCCGAGTTGAACGAACTTAAAGGCACCAATGTGCTGCTGTTGACGCAATTGATGAAGCAGCATCTGCAGAGGGACTTTGAGAATAT
CCACCAAGCGGTAGCGGACGATTTTCCCGAGATTTTCGCGTCACTGCCGATAATTACGTTGGAGGAC