Description :
From Genome Similarity Track
Location :
Scaffold_1014:5795- 6868
Sequence
1073 bases(100 bases per row)
TCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACAAGACAAGTTTGATGATGGTT
CCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCACCGGCAACTTGATCTGGTTCCCAGCTATCCTCAGGCAACAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACC
AACCGAGTGCTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGAGCTAATTTCTTCGTCAAGCCCGGTTTGACGCGTTCCATGTA
CAACCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAGCTTCTGGAGGGTTCGCCGTGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTATGCTTTTTAGCCCTTCGCTCTTTTTCTACAGCCTGATAATCTTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCGCGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGC
CCGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCC
GCGATTTCATCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGATCCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTG
GCCGATAGCTCAAAGTCGCTCGTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAAAACCTCGCTCATGAA