Description :
From Genome Similarity Track
Location :
scaffold_1067:5794- 7584
Sequence
1790 bases(100 bases per row)
ATGTTTACTACGTACTTTACTTTGACGGTGGTTCTCGGGGCAACCCGGGCCCAGGTGGGAGTGGCACCGTAATACTCAAGGTGCAGACGGGAGACCGAGC
GCCATATCCGTGCTGGATAGCCAGCATGGCTTACGGCAGCAAGGGTACCACGAACAATCAAGCTGACTGCTTCATGGACTGACCTACGCTGTGCACGCGA
AGCTGCCAAGGGTTCACGTCGTCGGGGACAGCCAATTAATCGTCAACTGACAACTACATCGGCGCGCGCCGAAGGCACCACACCTTAGCAAGCTGTACCA
CCGCTACAGGTTTCTGGCAGACAAATGTGGAGTGATCACCTGGTCACATCACTACCGAGAGTTCAACCACACGGCTGATGCGCTTGCCAACTTGGCCATG
GACACTGGCTGCAGCAGACAAACGTCCCTGATGCTACAGGAGAACCACACGGCCCTTGGGATCCGGCCTTTTAACACATGCCTCGAGATTTTGAGGAATG
GCAAACACGTATCTTGGGTCAAGAAGACTCGAGCTGATCACCGCAGTTGACGGTGACCCAACCTTAAGCTGTTAACGAGAATGGGCTGCAGCTTCGGATA
TTAGTAGTCGTTAGTGCGCTAGTGCTAAATGAAAACAATATACCTCACCTGAAAAATGAAAATGAAATCACTTGTTGGCGTTCCTCGATCAGCTGCTGTG
CATGACGGCAGGAGTCGGAACACGAGTGAATCTTGACAGCACACACGTTAATCACGAGACCATCACTAGCCTCAGATGCCAGGCATTCATGCGACCCCCA
TTGGGGCATCACACCAGCGGTAGGTCTCAGTCTCTGTCCGGAATGCAGTGTACGGTGGACTCGCTGGCTTGACTCTCATCTGGTGATACCCTTGGGCGAG
ATCAATGACACTAAAATCACTGCAAGAGCCATTTGGTCGAAAAACTCCTCAATGTTGGGCAACGGGATCTTAGGAACCAAGGTTTCGCTGTTCAAATAGC
GGTAATCAACCACCCACCTAATTGCCGCTGTAGGACTTCCACTGCGAATCCATTCGCGCCGGCTCTGTTGTTTTCCCGTCTTGCGATCGCGCTTCGGAAT
CCCGAATACGTTTGAAACCAAGGGAGAGTTACTAATTTCAATCCACTGCTTCTCCAGTGTGGTGAAGCAGTTTGCGTGGAAAGCGGAAGGTGATGGTTAG
CTACCGCGTTGGTGGGTGACACGATGGCAAAGTAGCAGATGACGCAGCAAGATCGACAGAAAGGATGCCTCAGAGGTACTTTGGTGGATCCTGACCAGAT
AGTGATGCGAGCCTACATTAGGATGGATCCTCAGCTAGGACACATCGGATCCTGGACGGATCTCGTCGGATTTTGAGTAGATCCTGGGTCGGACCCTAAG
GTAGGATCCGAGTCGGATCCGAGCATAGAGACGATGGATACAGACGGATCCCATATCAGATCATCGGTAGAGGATAGCCAGTGTGAATCAGGATCCCATT
TGGGATGGGACGATACAGGATCTGGCTAAACATAAATCAGAGCTCAATTTGCCTTGTACTAAGTGTCTTCGCAACCAGGGAACGGGAAGTATAATTGCCC
CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCACCCCCCCCCCACACCCCCCCCCCCCCCCCCACCACCACCACCCCCCCCCCCACCCCCCCCCCACCCCCC
ACCACCCCCCACAACACAGACAAACCTCCCCCTCCTAACAACTACCACAACAAAAAGAATAAAAAAAAAACAACTAATGAACTGACTCAA