Description :
From Genome Similarity Track
Location :
Scaffold_67:57938- 60394
Sequence
2456 bases(100 bases per row)
GAATACCCGGACGTCTTTACCGATAAGATTCCCAGCCGGACTGTCTGCCGATCGGAGGCGTCCGCCCCGAGATCGATCTCGCGCCCGTTTCGAAAGTCCT
GTGTGACGCGGCAGTGCCGCTGCCGCGAGACCAAGTCAAGGCCATCGACGACTTCTTCGAGAATCGCCGTAAAGCGGGTCACGTGCGTGAGAGTGTCTCT
CCACATTCGAGCCCAACGTTCTGTGTGAAGAAGGCCACAGGCGGATGGCGCATCGTTCATGCCTTTAACAAGTTGAATGATGCGACCATCCCCGCGCAAA
CCCCAATTCCCCGGAAGGACATGGTGCTCGACACCATGGCGGGCAGTGTCGTCTTCAGCGCCATCGACTTGACCGATGGATTCTATCAGATCTTGATGAG
ACCGAGCGACATCCCCCTGACAGCGGTCAGCACCCCAGCGGTATGCTCTGGGAGTGGCTTGTGATGCCACAAGGCTTGAAGAATGCTCCCGCCACGTTCA
ATCGCATGGTCTCCCATGTGCTGCGTCCGCTTCGAGACTTCGCACCGAGCTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGATGGTCTCAGCGC
GATAGAAGTCCACTTGAGGCACTTAAAACAGGTCTTCCAAGTGATGCGCGAGAACAAGTTGTACGCGAACCTGAAGAAGTGTATCTTCTGCGCGCCGGAG
ATTCCGGTGCTGGGCTGCTTCGTGGGCAAGGACGGCGTTCGCGCCGACCCGGAGAAGGTGTCCTCTATCTGCGCATGGCCGTCACCAAAGAACCCCACTG
AGTTGCGTCAGTGGTTGGGGCTAGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGCCCCTCTCATCACACCTGAAGAAAGATGC
CACATGGGTCTGGTCACCCGCGCACCAAGCTGCCTTCGACTCAGTGAAGAAGAGCCTCGCTGAGACGCCGATCCTAGCTCTTCCCGACGACTCGAAACCA
TATCACGTCGTTTGCGACGCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCAGTTTGACGACGAAGGACGTGAACGGGTCGTCAGCTATCAGTCTCGAC
AGATGAAGCCAGCGGAGCGCAACTATCCTGTCCACGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATTAAATTCAGAGTGTACTTACTCGGCGAGCA
AACCTTCGCAGTGTATACCGATCACGCATCGCTAAGGACAGCGATGAAGAGCCCTCATCTTTCCCAGCGAATGGCTCGCTGGTTGTCGTTCTTCTCCGAG
TATAATTTCGTGGTTCACTACAAACCCGGCAAGAACAACATCCTTGCAGATGCTCTGTCTCGTCGTCCAGATTACGACCCACGCGATTCGCTGGGTCGAC
AACCGCTGCATGATGAAGACGACGAAGACAACTGTGCTACGTGCTTGGCGTCGGGATTGAACCTGACGAGCGTGTCTTCAGAAACCCCACTCCGCGACGA
AATCCGGACTGCGTATGAATTCGATCCGGTCTATTCGAGTATCTTGGAACATCTCCGCTCGCCCAGTGAAAAGACACTGAGTGCTTTGTCCCGCTCCACA
CGCCATCAGATCGATAGTTATCGGATTGAAGACGGGCTGTTAACGTACAGCATCGATCGCTTCGATGCTTCGCGTGTAGTGGTTCCCAACGATCCTGACT
TGCGCTCGCGGATCATCCACGAGCTCCACGATATCCCCCTTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCAGTGTCGCGCGACTTTTACTGGCC
CCACATGTATAAGCGGGTGCGCAAGTGGGTGAGGACCTGCGAGATCTGCCAACGCGTGAAACCGTCCGCGTCATCGCAGGCTCCCCTGCGTCCCTTACCA
GTGGCCACCGAGGCATGGCGCTGGGTGTCGATGGACTTCGTCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACAGGT
TCAGCAAGATGGTTCACCTCATCCCGGTCCCGGATACGATCACCGCGACCGATACCGCGGTGCACTTCGCGGATGCAGTCTTCCGTCATCATGGCATGCC
CGAGTCCATTGTTTCGGACCGCAGATCCGCGGTTCACGTCTCCTTTCTGGACGAAGCTCTCCGAGCTATCAGGGACAAAGCTGCTGATGTTCGACGGCCG
CTCATTCGGAGACGGGATGGCCAAACCGAGCGAGGTTAATCGCGTTCTGAGGACGTACTTCGCAGCTATGCGACGTCGTTTTCGAGCTGGAGCTCGTTCC
TTCCGCTTGCTGAGTTCGCGCTGAACAACGCGGTTCACGCGTCGACTGGCTTTGACTCCTTTCTTCGTCAACAACGCTCCGGCACCCTTGCGTTCCAGCT
CTCCTCGCCGTGGGCCGTCCCACGGCGCCGTGTGGCTCCACTCTGGGTGGGGGTGA