Description :
From Genome Similarity Track
Location :
Scaffold_67:57935- 60827
Sequence
2892 bases(100 bases per row)
CGCGAATACCCGGACGTCTTTACCGATAAGATTCCCAGCCGGACTGTCTGCCGATCGGAGGCGTCCGCCCCGAGATCGATCTCGCGCCCGTTTCGAAAGT
CCTGTGTGACGCGGCAGTGCCGCTGCCGCGAGACCAAGTCAAGGCCATCGACGACTTCTTCGAGAATCGCCGTAAAGCGGGTCACGTGCGTGAGAGTGTC
TCTCCACATTCGAGCCCAACGTTCTGTGTGAAGAAGGCCACAGGCGGATGGCGCATCGTTCATGCCTTTAACAAGTTGAATGATGCGACCATCCCCGCGC
AAACCCCAATTCCCCGGAAGGACATGGTGCTCGACACCATGGCGGGCAGTGTCGTCTTCAGCGCCATCGACTTGACCGATGGATTCTATCAGATCTTGAT
GAGACCGAGCGACATCCCCCTGACAGCGGTCAGCACCCCAGCGGTATGCTCTGGGAGTGGCTTGTGATGCCACAAGGCTTGAAGAATGCTCCCGCCACGT
TCAATCGCATGGTCTCCCATGTGCTGCGTCCGCTTCGAGACTTCGCACCGAGCTACTTCGACGACATCTTCGTGCACAGCCGCGCTGAGGATGGTCTCAG
CGCGATAGAAGTCCACTTGAGGCACTTAAAACAGGTCTTCCAAGTGATGCGCGAGAACAAGTTGTACGCGAACCTGAAGAAGTGTATCTTCTGCGCGCCG
GAGATTCCGGTGCTGGGCTGCTTCGTGGGCAAGGACGGCGTTCGCGCCGACCCGGAGAAGGTGTCCTCTATCTGCGCATGGCCGTCACCAAAGAACCCCA
CTGAGTTGCGTCAGTGGTTGGGGCTAGCAAATTATCTCCACAAGTACACGAAGAATTACGCCGGATTGATCCAGCCCCTCTCATCACACCTGAAGAAAGA
TGCCACATGGGTCTGGTCACCCGCGCACCAAGCTGCCTTCGACTCAGTGAAGAAGAGCCTCGCTGAGACGCCGATCCTAGCTCTTCCCGACGACTCGAAA
CCATATCACGTCGTTTGCGACGCGAGCGACTTTGCCATCGGCTGTGCGCTGATGCAGTTTGACGACGAAGGACGTGAACGGGTCGTCAGCTATCAGTCTC
GACAGATGAAGCCAGCGGAGCGCAACTATCCTGTCCACGACAAGGAGCTTCTCGCGATGCGCTACGCTCTGATTAAATTCAGAGTGTACTTACTCGGCGA
GCAAACCTTCGCAGTGTATACCGATCACGCATCGCTAAGGACAGCGATGAAGAGCCCTCATCTTTCCCAGCGAATGGCTCGCTGGTTGTCGTTCTTCTCC
GAGTATAATTTCGTGGTTCACTACAAACCCGGCAAGAACAACATCCTTGCAGATGCTCTGTCTCGTCGTCCAGATTACGACCCACGCGATTCGCTGGGTC
GACAACCGCTGCATGATGAAGACGACGAAGACAACTGTGCTACGTGCTTGGCGTCGGGATTGAACCTGACGAGCGTGTCTTCAGAAACCCCACTCCGCGA
CGAAATCCGGACTGCGTATGAATTCGATCCGGTCTATTCGAGTATCTTGGAACATCTCCGCTCGCCCAGTGAAAAGACACTGAGTGCTTTGTCCCGCTCC
ACACGCCATCAGATCGATAGTTATCGGATTGAAGACGGGCTGTTAACGTACAGCATCGATCGCTTCGATGCTTCGCGTGTAGTGGTTCCCAACGATCCTG
ACTTGCGCTCGCGGATCATCCACGAGCTCCACGATATCCCCCTTGGCGCTCACTTGGGCCGTGAGAAGACATTCGCCGCAGTGTCGCGCGACTTTTACTG
GCCCCACATGTATAAGCGGGTGCGCAAGTGGGTGAGGACCTGCGAGATCTGCCAACGCGTGAAACCGTCCGCGTCATCGCAGGCTCCCCTGCGTCCCTTA
CCAGTGGCCACCGAGGCATGGCGCTGGGTGTCGATGGACTTCGTCTTTGGCCTCCCACCCGACTCCGCCGGGCGCTCCGGTGTCCTGGTATTCGTCGACA
GGTTCAGCAAGATGGTTCACCTCATCCCGGTCCCGGATACGATCACCGCGACCGATACCGCGGTGCACTTCGCGGATGCAGTCTTCCGTCATCATGGCAT
GCCCGAGTCCATTGTTTCGGACCGCAGATCCGCGGTTCACGTCTCCTTTCTGGACGAAGCTCTCCGAGCTATCAGGGACAAAGCTGCTGATGTTCGACGG
CCGCTCATTCGGAGACGGGATGGCCAAACCGAGCGAGGTTAATCGCGTTCTGAGGACGTACTTCGCAGCTATGCGACGTCGTTTTCGAGCTGGAGCTCGT
TCCTTCCGCTTGCTGAGTTCGCGCTGAACAACGCGGTTCACGCGTCGACTGGCTTTGACTCCTTTCTTCGTCAACAACGCTCCGGCACCCTTGCGTTCCA
GCTCTCCTCGCCGTGGGCCGTCCCACGGCGCCGTGTGGCTCCACTCTGGGTGGGGGTGAAAGAGGCGACAACCACTTTGTGACAACTCCGGTTTTGAACC
CACAACCGGTTACCATACCGGTTGCCGACAAGCCTTCTACGCCAACACCGGTAATGGACCCTCAACCGGTTTCCATACCGGTTGCCGACTTCTCCTCGAG
TGCAGCCTCATCTTCAGCGACTGTTAACGCAGTGACACACGCCCAGGCCAGAAAGGCCCTGACGACTCCCCGCGACGCAGTGTCCCCTCTCGCCTCGTGG
ACGAATCGTGCCCTGATCAGTCCTGGCACCGCTAACGCGGTGTCTCCATCAGCGAACTACGCGCCAAAGCAACCGGCACATCCGGCTGATAACACCGCTG
TCTCAGACTTCCTCCTCCAGCGCCAAGCAGTCAATCGATACGTCCGCGACGCGCTGCAGACGGCGGTCGACAAGCAGAAGGAAAACGCGGAC