Description :
From Genome Similarity Track
Location :
Scaffold_98:5792- 14365
Transcript NameFunction/comments
Phyag_g2010hypothetical protein PHYSODRAFT_345503
Phyag_g2011hypothetical protein
Phyag_g2012hypothetical protein PHYSODRAFT_491946

Sequence
8573 bases(100 bases per row)
ACGAACACGGCGCGCAATGAGGTGACTGTACTGCGAGCCGAAGTCCAGGATCGCCACCTGCTTGCGGTTGGTCACGGGGGAGGCGTCGGCCATGGTGAAC
GAGTTTGGTGTCGGACGGAGGGCGTGTTCAGTTctgccaccagcagctcccaaCCACCAAGAGCTGACTCGTTGTTGACAACCAGCCATCGCGCGTGTCA
TAAGATGGCTACACGTCGCcgtttcagccaatcacagtGTTCAATCCGAAACGACGCGCACCCCTAATTGAGCCAAGGACGGACTTGCAGCTTGGCGTAA
GGCGGCGACGCCCAGCGCCGACACGCACGGGTTCTCGAGCAACACGAGCGTCTCCAATTGACTCGAAGCCAGCACTGGAGCCAAGTAGCCCAGCACGCCG
CGGTCCGATAGAAAGTTGCGActcagcgccagcacgcgcAGTGGACTGTCAGCCAGCAGAGCTCGGGCGAGCGATGGACACGCAGCGTCGGCGATGTGGT
TCCCGCTCAGGTCGAGCTTCCACAGCGCGCGATTGTGTGTCAGCGCCTCGAAGAGCGCGGCGGCACCGGCGCTTCCCACTTGGCAACGCTCAAGtaccag
ctgctgcagacaaCTCGGACTCTGGGCCAATGCACAGGCGAGTGACACGACAGACGCGGGAGTCAAAGAGACGTTGGCTAGCACCACGGACACGAGCGCG
AGGCCGGAGCTGCGTCGACTGCGCTGCAGAATGGCGGCTAAAAGGGATGCGTGTGAAGGTCGGAGTGGCGCGTTGCACAGGATGAGGGATTGCACAGGGC
ACACGCTTGTAGTGGAGCTGCAATTCTCATTCAGGGCGTCCACGACTTCCTCGTTGAGGTTGAGAagcgagctgcttgaggtAGGTCTGGTACTTGACAG
tccaccgccgccatcgACAATGATGCTGGTAGATAACGAAATCAACTGCCGCAGCTGAGGGGCCTTGAACACGGTGCCTCCGCTGGAATAGGTGGGAAAA
TtggtgagctgcttggcAACATCGATGGCGTGGGTATTTAATACTGGATCTTACCTGTACGAGAACTGGCATATTCCGGTTTGACGGACGCGATTGAGCA
ACGTGAAGAAAAGCATGGACGGTATCTCGGCGCGCTAAAATGCGAATCAGTCGTGAGTTAGCTACAGATTTACATGAATCGAAGCAATGTATGCAATAAC
TTGCCTCCTCAAGTATAGGTAGCTTGTCGAACTTGCCCCAAGAAGCTGTGGCAGGTTTCCGCTGGCCACTAACGGGTGTGGTTTCCCGTGATCCTATCAG
CGACGAACTTCGGACGCGCAGAACACTCTTTTCGAGTAAGGCAGCGGCTTCCCATTGACGGAAGCAGCGTTCCAAGGGTTTCTGCGAAGCTGCGGCTAAC
AATCTCGCCTGTGCTGCCTTTTTGGCCACGACGCAACGTGCTTGATGCTGAGCCCGATGGCGTCGGAAAGTTCGCTGTACCAGACATGCTGCCTCATGCT
TCTCTTGTCTCCGCAAACGTACTTCATCTCGCCAGCCAAAAAACAACCGACGAACTCTTTGGAACGCTATTTTCCTCGCAGCTTTCTCACCACGTTGACC
AGCGACCGAGTGCCTATCGAGGGTACTGAGGTATCGACGACGCATCAGCCAGCTTCGCAGTTTGTGTTGGATTttggttgctgcagcgtaTTGCCGAGCT
TTTTTGGCGATGCATGCTGTACGAAGTTCTCGGAAAAAGTTTCGTGCAATGGTGTAGAAATTCTGCTGCAGTCTGCCCAGTAGTCGTCGCTGAGCGGCAC
GGTTGCTGAGTGCACGAAGCATTCGAGCGCGCTTTAgtcgccgtctccaccatTTTTGCAGCTGGACCACTGCTGCATTGCGTTGTCTAACGTAACGTGA
TAACGCTAGCAAGCAGGCCCAGAGCTTGATATCATGGGGCTGGCCTTTCAGCCCACCGCCAAATGTTACGGACCCAAGGACCAACATTTCCGCCGTACGT
CGCCGATGCAGCTTTTGACGACTGTAAACTCCCCGAAAGAGCCCCTGGATGCGGATTACCGCGGCAAACCTCCTTCGGTGGTACGCTCGAACGCGTTGAT
GGAGAAAATCGAATCCTATTTGCAGAAGCTGAGTTTCGCGCGAACGCGTCCGCTTCACAAGTACATTGAgtgctcgtcgacgtcgtgcaCGAAGTCGTTT
CGCCTGTCGTCGGGCGAGTACGCCCCGCATGTGTTTTTGGATCGTCACAGCTGCACCTCGCTTGCGCAGTCGATGAACAAGCGCGTGGTTTGCGAGAGCC
CGCCAAGAACTCAGCAACACTTGTTGCCTGTGGTCTGAGAGCAACCGATTCATTGTGGCAGTTGCAGCTCGGTGGCGCTGTAGCTCCGCACGATACCGGC
ATACAGCTAACCTTGAGCGGTATCCACGTTGAATGCGCCGTGAAGCCCAATCACGTTCGGTTCGAGCTTCAGCAAGCCAGGAATGCCAGGCCTGAAACAC
GCGTGAAATCAGGGATGCCGATCGTCGTACAAgacactgctgcagaattccattttgctgctgacgcagcaacatcaactgAAAGTAGAGTTTCCGGCTA
CGCCAAGCGCGGAACTGCCGCTGGATGTGCACAACCGCATCGAGACGCTCTTGCTTTTGAGTTGAAGCAAAGTTACGCCACCTCCGGAAAACTCCAAATT
GACCGAGTTCAGTGCGGCGGCCAGCAAACTTTGCCAATAATGCTTCACGCTCTAGCTTTCGTGCTCTCAGAGCTCGAAGTGTCCGCTTGTTTCGCGCGAT
GGGAAGAAGGGATTGAATTTTCCGTGCAGCGTCATTCAACCATAGTTCGATCAGCCGGTCGTCTTGCTTACCCATGGTTGTGTTAGCGAGGGCTTCCTTC
TCTCGCTGCTTTTCGCGCAAGTATTCAAGTTTCTGCCGTGCTTTAAACCCTCTCAACGCGCGTTGAATTCGTATTGCCATCGCATGACGACGCTGTTCCA
AAACATTCACCACACCGAGACGCCATCGTGCTAACTTCCAGCGTCGCCGAAGCAATGCTTGTAAACGTGTAGCACTCCTGTTTTCCAGCGCGAAATGAGA
GCGCCATGAATCACTGCATGTCTCCAGCAAAAATCGTTCATGGTGAGCGGTATAGTACACGTCACGTGGGAGCTGCAAAAGCGCTTCAGCGAATGCCTTC
TCAGCTCCCTGGTCGTTCCCGGTGCGCAGTAGACTAGCACCTTCCAGAAGGAGTTTTGCGCCAGGAATGCCGCCTGAAGCTGGTTTCAACCTGTGGCGAG
CTTCACGAAGAGCTGCGAGAACCAAGAGTGGTGCATTGGCTGGTCCCGCAAGTCGCTGGGCTAAGTCCAACCAAGTCTGCACATCACGACACCATAACAG
CGTGCGTTGTTCCTCATTCTTCCGCGACGTCGTGTAAAAAGTGTGCGCAGTCTTCTCTGATGGCAATACCGGCGGAAGCGCTACCAGAGCTTTATACGCC
TGGGTGTACATCTCACGCTCTAGTGCACGCATACCTGGAACATGCGAGAgttccagtgctgctagcAGGCTAAACTGGTAGGCAGCGAGGCGATACGGAA
AAGACGATGACGGTCCTTGCCCCTCAGCTAAGTACTGAAAGTACTGTGCGCTCTCGCGATTCCGGCCAAGTGCTGATGCTGTTAGCGCCGTTAAGAAGAT
GGCTTCGTTGAGTCGCGGGGATGTTGGATATCTTTCGACCAGCAGCGTACACACCGCAAGCGCGCCTCGGAACGATCCAAATTCGATGTAAAGCCTCACT
AGTGGGAGCAGCAGTTCTGGGCTCGATTTGCTGTTCGGATACTCCATTGCAATGAGGAAGGTACTATAGGCCTCTTGGAGAAGTACGATGTGAAGTGGCT
TGGAATCTGCACTAACACGTCGAGGTCGTATGGACTGCGTTACTGCTGTGATTTCCAGGATAGAAGGCATGTGCAAGGCTCTGACGTGGGCTTCCCATAA
CTGGAATTGTGTGAGGGCAAGCTCTGTCCAAACCCGTTCTGAATCACCATCCCGCTGCCAGGACGTGTTAACCGGTACATGTCAGTATGATATCGCACGA
ATAAAGTCGTAAAGGTTTCAATTGCGTACCTCAATGATACTCTCCAGCGCGTCTACAGCAGCTTGATACATTCCACGATGTCGATCCTGGATTGCTTGGA
CATAAGCTGCCTTGGACTCGTCgctcgagaacgacaagtCGCCATCTTTTCCGAACTGTGTCGTCGCGTGTACAGTACGATTCATCGCTTCAATAGTATT
TGCTGCCTTCTCTAAATCATCACCCTTAGTTGCCCATGAGGAGCAAATCGGCGAGGTCTCTGGAAGTGCTGCGAAAGTGGCTCCCAAATATAAACTAACG
TTATCGTCATTCAGCAACGCCCTTGCTCGAATGCGCGACGCATAGGTTATCGAGCTCGCACACAACGCGGATACTTTTGCTGCGAAGTTCAAGTGTCTCG
GGTCCTCGAACATGTGCCTTAACAAGTTTCGCCATTTCCAGAAACGGAACCATGGCTTCAGCCCGCCGAGCAGAGGTCCCTCGAGGTAATTTCTTGCTCT
GGTCATCGAACTCCAATTGTTGCTCCGTCTTGTTAATCTCACGCTCTAGTGAACAAAATATGCTACAACATGGTCGATCCTTGAAATGCTCGGCGTGTGG
GGGTTGCACAAATTCCCCAATTCGCTCTATCAGCGAGACCACAAACAAAGGATCCCTGACGAAAAGAAGAGAGCTAGTACGACTGAAGTACTTCTGGACG
AGGTCTGCAAGCTTGGAGAaatggagctcgaggcttAAATCCCTCGTGCTCCTGGCGAGAACAAACATTTCTTTCCAGTCCGCATCCGCCCAGCGCAGCG
GGCTCAGTAGTATACCCAGAGCCTTCACACAGTGTTCATTAAGCGTGGACGTTATTGAGACCGAGCCCTTCACAATGTCACCAAGCGAACCTGTACCAAC
AGTGTGATGTCAGTTTTACACTCCACAGCCAAAAGGTAACAGTAGAATAGTCCTACCAATTCCGAGCAGACAGATCATCTCGAGTAGTCTACCAGCGGGG
TAGTTTTCGTAGATTGCCATGAACTTATCAAAGGATACTGTCGAGGCTccatcgagcagctccattaTTGTAGTTTCGGACAGGGCTTCGTTTCCGAGAG
TTTGCTGAAAGGTGTTGAACTTCTGTAGGCTCCATTCACCGCTGTGGTCTGCATCAAAGGCGTCAAAAATCATTCTCATCGCGCGTTCTCGATTATGTCT
TTTGCCAAGACTAAGCAGCATGGTTGCGATGTGCTGTGAAGCTTTCACGATATCCGACAATGATTGTTCGAGCTCGCCCAACACGAAAAAGCTGCGAACT
CCAGCAGTAAAGGACGTGCCCGTGCACTCCTTCACCATAAAAACATGATATGAGGTGCTTAATCTCGTCTTGCTCTTCAAAAACATGTCTCTCACCTCTA
TATTCGATACAAAGTCTTCGCGGAAGTCGATGCAGATGCGGAGATACTTTTCATGAATGGGCTGAACACCCCCTTCACTTCGAACTGCCGAGTGCATGGT
TACTGCAGTACAGACCGTTTGTCAGTTTTGATGTTAGCACCTCGCAACCAAACCACCATTTTAAGTATCGTTTGTGCGAACCTGAGCATTTAGCCCATAG
AGATTCAAATGACGACCACACCTGGTCTTGTTGTACTGCTCTCTCCACCGTCGATGCCAAGTCAattccttcttcatctgttAAGCATCATCGAATGAGa
acttttttttctttcaTGTTAGCAATGCCATAAATCTTACCTGTGATTTCTGGGTTCAACAAGAAATTGACCATCAGGCGCATACCATCGAGCTCGGGAT
CTTCGAGTCGACAGTCATCGCTGTGATAATCAAGTTGCCCTTCCTTTTTTACCTTCTCCCTGCTGCTAGCTCCCGCACTAGCATCCGTGCTACTTGGTGG
TTGGATCCCCAGTCGAAACCTGATGTTATTTCCAGGGGGAGCGCCTTCGCGTTTCGACGTCCGAGAGCTTGCTGGTCGTATTTGCATTGGCAACCCGTTC
TCACCCACTCGGATGCTAAGGCTCCATTGgagctcgccatcgtcaacatcaGGCTCTTGAGCGACATTCTGAAAGCTCTTTAGGATACGCTGTCTAGCTA
CGGCTGTCAGCCGACGGGCGTTAGGCCCAAGAGTCTTCATTGCCCTTTTGATGATAGTTGTAAGCATAGCATTCATGCTGTCCTCCATACTTTTAACACC
GTCGACAACGAAACCGCTCACTATCTCCCATAGAGCCTCTGGTTTCTCTCGCCGCCGGTTTTCCACCCATGTTTTCATGACGCGAAGGATGTCACCGCAT
CGCACAAGTCCGAATTGATCTACGGCCAAATCCCGCACAAGCGCTGTGGCCTGCAGGCGAAAACAGCAACGCATAGATGAGATCTTGCCATCGAATTGCG
GAGTGCCACGCTGGAAAACCCCACCTCACTCCGTGACAGTGACAAACCACTGTCCGAAACAACGTTGGCCAGCCGCTGCAGTGTGCGCGCATCGACATAC
CTTTTTACCTCCGCAGCAGATAGCACGCGCAGCGACTGGTTTGACCCCTTTGGGGGAGGTGGGCATAACACGCTTTGGAGTTTGCGTGTAATACTATCTG
CGGTGAGGGCCGCTGGGCCTGTTAGTGATCGCTGACCCTCCTCGCCTGTACCTGATTCACTATGAGAGCTGGATGTAGCTGCTTTTCCTGTCTCCTCTGC
ATAACGATAGAATTACAAGAATCAGCGGAACTAAACAGCATTCACAGCCAACATTACCAACCTGACGCTGCTACTCGTTCTGCTTGGTAGTCGAGATAGG
CTTTATGCCTCAGGAGTTTCCCCTGCTGTATTAACAATTCATccgaagatgctgaagctccCTGTGCACAGACACAAAACATTCGCATTATTAACTTGAA
CAAATATCCCCGAGCTCCTTCCCGATGTCAAGCGCATACCGCCTCAAGGTCGCTCATGAAGAATAGGATCTCTGGGTCTGCGAGCGCCTTTTCCACGACT
GTTTGCCGCAAGACCTCGTTGCGCTCGCCGAAAAGCCCTACATCACGATAGGAATGCTATATCAGCTCGCGTCGCTACAATACAATACGATATGCAATAG
TAAAGATACATACGTCGAATCAACGGCCTCACGGTGGCCTCTTGCAGAACGTCTGCTCCTCGAGCGAACATCTTCAACCCCCTGGCAGCGGCCGACACCA
CCATTGTGAGCTCGCACTTGTTGAGCGTCTTCAGCCCTCCATTGTCCAGCAGAGACAGCACAACTGACGGCACCAGATCAGACTCTGGAGGGATAGATAC
TAGTACAGTAAACGTTATGGTCTCACACTCGAGTTTCTGGGGCTTCTTAGCGTCCACCAAGAGCGCCAATCCACTGAAGAAGTCCACGACTGCAAGTTTT
CGTGCCTTCTTCAAATCCAGCGCCTCAAACATGgccagcaattgcagcttATTCTTGTCGGGGCAAAGCGGCGCCACGATGGCCTGGAACACGGGGAACG
GCAGGAAATACTGGAACATGGGGTCGGATCGGCGGCGGTGCGCCTCCTGCTGGAAACGCAgatgcagctgctccagctccacccACGAGCGAGGCACCAG
CGaccgcagcttccagcgcacgccgccgccgtccgCGCTCATGGTCTGGCCCATGTTGAAACTActaccacttcaacaacttTCTAATTGGTCGGAAAAG
AAACCCAATTTTGTCCAATAGGATATCGTACTTTGCGTTGGATTTTTTTGCTTGACAAAGTCCCTTTTAGTGTTTGAAGtgccgagatggagaacaAGTT
CATCCCGCAGGCGATCGAGATCGTGACGCAAGCCATCAATGaggacaacagcaagaactACCAGGAGGCCTTCCGCCTGTacaagaaggcgctcgagCAC
TTCATGGTGGGCGTGAAATGTACGTTTGGTTCAAGTTGGAACTCGAGGGGCTTTGTGTGCTGCGTCCTGAGCTGCTGTCTGACAGACGAGAAGAACCCAA
CGTCCAAGGAGATCATCATGAAGCGCGTGGAAGGGTACATGACGCGCGCGGAGCAGCTGCGGgggatgctggagaaggacagcGCGCCCAAGGCCGTGGC
CGCTGCAGTGGACATGGACAAGTAAGTTTACATTGGGTCTGATAGGGAAGTATTCAGTTTGGAAGTGTGATTCTGACTGTTTTAATGCTGTGCGCAGAGG
TgacaaggaggacgacgatgagacGGACGCAGAAACTGCCAAACTGCGCGGTTCGCTGGCTTGTACGTTTGAAGAGATCGGTTGCGATTGCTGTGGCGAA
TTGACGGGCTTTTGGGTGCTTCTTGTGCAGCGGCGGTTGTGTCCGAGAAACCTAACGTGAAGTGGGACGACGTTGCTGGACTGGATGCTGCGAAGGAGGC
GCTGAAAGAGGCTGTCATTTTGCCAGCGCGATTCCCGCAGCTTTTTACGGGGAAGCGGCGCCCTTGGAAGGGA