Description :
From Genome Similarity Track
Location :
Scaffold_538:5791- 10505
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_538-abinit-gene-0.11HECT E3 ubiquitin ligase

Sequence
4714 bases(100 bases per row)
AGCGATGGACGTTCGCAAATATCGACGATTGTTTAGCTCTGTCGCCATCCGCAAATTTCTCGCCTGCCTTGTGCTTGATGCGCTACCACCTGATGCCGAT
GACTCGGCAGCAGGACAAGCAATCTGCGAGTGGGTGAGAGACTACTATGCGAGGAAAGACAGTTCGTATCGGATGCTGGTCCAACTCGGCAAAAAGTCGC
GACAGTCGGGACATTCAGTAGATCCGCGCGACGAACAGATTCGCGCTAATGACATCCGGATCGAGTCGGCGAGCTTCGCGGTTCTCCTACACCACAACGC
GCTTGCAATCCAAGCTCTCCAGTTAGCACAAACACACCAAGTGGGTGGCCAACACAACACCCAACGCCCACCGCCAGCCAGCTTCCTGAGGCTCTGGAGT
TTCGTAGCTGACTTGCGCCGCCAACTAGCGGCCAAGAAAACAACTTTGAAAAACCAAATCTCCAAGAATCAAGACGGGGACACAGGAGATCCGCTTGACC
AAATCCTTCGGCTACAGCGAAGGTGGATAAATCGGTGCGAGCTGCTCGTAATGCTGGATGTTCACGACGAGGAAGAACATCGCAATCTCGAACGAGATGC
AGGGTTCATCGCTCCTTGCAATCCAGCATTTATCAACTCTTCGCGTATCCCAGCCAGTGATTTCGAACCGTCGTCATTGAAAGCGCACATGGAGACTCGA
TACACTGAGCATGACCTCCCGTTCGTAGTAGCATACCCCTGGTCGAAATGGCGGCTCGTGCGCACTCTTGTGCACACGGCCGCTCGATGGAAAGCATGCA
GTTCCGGCCACAAGATGATGAAAGCGAGCTCGACAATCACCTCCACCTCCCGCCAAGCGATTAACTTTATCGCATCTGAGGAACCGGTTTCGTCGCCAAT
GGCGATACGACAGTTGCTGGTAGACCCTTGCCGGCGCAGAAGCTGCTCAACCCGTGGATTTGAGATGTTGTGGGAGATATTGTCTACTCTATCGTTCGAG
TCAATACAGGTCGACGTCGTCCACCAAGTCAGCCAGGCGCTTGTGTTTCAACATGCAGGTGTTGAAGAGGCTCCGGTGCTCCGCAACTCTGGCATTTTCT
ACACGGATTTGTACAACAATGCCAAATCGGATCTGTTCATGCAACTGACGGATTTGATTGCACACAAAGCTGCTGGTGCAGTTGAAGCGGACGATTGTAA
TGGACCCGGAGCAGATTTTTGGATACTGACGGAGCTGCTGAGTTCGTGGGGGTGCAAGTTCGACATCGAGCAGTTCGAGTTTGTCAGCGACATTGGCGTG
TTGCCGCTGCTGCAGCGATTGTTACAAGCATTTTCGGACCCCGATCTGGTGGAAATTGAGCGCGCGCGACGCGCGTTACCGTCTCGAGTGAACTCGTCAA
TAGCAGGAAACGACAGCAGTAGGTGCTCGGCCGTTTCATCTCGAACTCTGGGTCTGGCGTCTGCCAACAAACAAACCCAGAACCTGTATCAGACGCTGTG
GACCATCTTCCAGTCGATTTGTGTCAACTTCGCGACGCCAACGAGTCAGATGGGAGTCGTAGCAGACGACACGAACGCTGCTGTTTCTCCTGCTCTGGCA
AGTCCGTTCGAAGTGATCCACGTCGAAGCAGCGCGCCTCACAGACGCAGTTGTGCCCCGGCGACCTGCTATCTCTTTGGATGCTGTGGGTTCGACTGCAA
ATGCGGCGATACGACGCAGTTTTGATATACTATCAACAGTAACACGAATCTCCCGCCTCCACAAACGCCTGACCTTTGACTACCAAGACATGCTGAATCC
TTCTCCTGGGAAAGTTCCCATGTCGCCGTTGTTGAAAGCGAATGAGTTCAGCATCACAACGTGGATGTTCATCGCTGGGCAGTCTGGCACAGCCGGGGCA
CAACCAACAGAGGGATCTCCAGATCGGAAGCTTGTGTTTTTGCGAGGCAATACCAATGAACTGAGCCCATACTTGATGTTGGTTCCAGAAGGCGTGGACC
TGTGGCAGATAGAAGTCGGCTTCGTCTTGGGATTCTCGAACGATGACGAGCCATCCAGGACCAAAAATGGCAATATCCTGTGCGAGCGTGTATTGTCCAA
GGAGCCGGTGCAGAGCGGTCGCTGGATCCACATTGCTATCGTTGTGGAGGCCACGAAAGTGAGACTTTACATAAATGGTGCCGTCGATTCGCAGCGCATG
ATTACGAGTCAGTACACTGCGGCCTGGGCAACACGGGATGTGGACCTGCCGTTTCAATTTGGGAGGTTCCCCCCCAGTATTTCTTCGTTACTTGATGAGA
ATAGGAGCGTTGTACCCGCACTTCGCCTCCTGTCGTGCTCGCTCTTATCCGCGAAGAGTTCGAGTACTCGGCATCCACCAATCGTCCCAGGCGTTCCAAG
TGATCCGACCGATTTTGGGTGTTTCGACGGATGGCTCAGCCAATTTCGTTTCCATAACCGGTCGCTGTCGCCAATTCACGTGCGTATCGTGTATGACGAA
CTCAAACCCGGGACTGTGGCATCGAGTCCAGCACAGTGCGTATTCGACACTGCGTTTCAATCCGCACGGCTGTTGGATATGCACGCTCTGCTCATACAGC
TAAGTTCGTGTCCCGAGGGAAGAAAACATTTTCGCTCTCACTTCTCGCAGTGGATGCTGCTTTTGTGGCGAACGTTTGTGTACACCCAGTCGACTCAGCT
GCAGCAATCGTCTTTGCGCGTCTTGCGCTCGCTGTTGCCACACCACCATCCCAGTTCTGTGGCCGACGCGCTGCTTTCGGTGGGCAAAGACGACGAAAAC
AACCTTGCATCAACACCAGAATATTTCGGTTTCTATAGCTCAGACGAGTTATTCGTTCAGCACGTGCTCCGGATTATTGGCTTTGGCCGAGCACGAGTCC
AAGCAACTGACAATGACCGAGGCAACCCGACTGGTGACACCATTCCAGCAATCGAGACTGAAGGCAAGGGTTGCAAACTGCCTTGGAGTCTGGTTATTCC
GGATGGGGTTCACGGAGCCGTTTTCTCACAAGTGAATGACTGCAAAGGCTCTCCACTGAATCAACAATTGCCAGCAAATATGGTTCAGCTGGAGGAAGCT
GCCAAGCAGCGAACATTGGTCGTCGTGAACGAGCTTGTCGAATTGATTCGGTTTCTGTTTGCATTGCGAAGAGACCAAACCAGCGCGTTGTGGACCAAGA
GCATCAGCAAGACAATATGTTCTATCCTGGTAAACACATCGACGCACGAGGGCACAAGTGATATTGGTCGCGACGCTGGCACATTCGTGTTTGGAAAATA
TGCTGTCCAACAAGCGGCACTTAGAGAGGCAGAGCTGACTGGATGCCTTTATCTTTTGGGTGGTTCTATGGAGTCTCTGCGGCCAGGAACCACAGCGCAA
CTCCAAATCACAGGAGACCCTGTTCGAATCATCGCTGTGGAATCGTTAGAATCGAAAGTACCGGGCGATAAGAACTCTGCTGGATCAGCAGCCTGCATCC
CAATGGACTCCGTGAACGAACACAATAGTGATATTAGACAGCTGACAAACAATCGATGCAACGAGCAGCGATATTCAGTGGAGAATGTGCGGTGTGATGA
GATAGTGCCGTGCCAAACCCAGAGCGTCCTGCAACTGAGTGTTCAGTTCCAAGATGACGATCGCGGTGAACAGTGGGATATTGGATCAATGCTAGCGCAG
CACACGCGCCTCATACTCCCACGTTTGAGTGAGCTAATGACGTCGGCGACTGCAACGTGGCCCGTTATGAATAATGTGATCGAGGCTGAGAAGATTTCTG
TCGAGCAGAATATGCGAGCGATACAATCAGGGAATCTGATGCTGCGCAGCGTGGTTCAGGCTATCGAAGACAAGAAATGCGCCATCGAACTCTTGGGCGA
CCGTGAATTGATGACAACTGTGTTCAAGCTTTCTGCCACCAATGATGGAGGCTCTGCTTTCGCCACCCTTACAATCGTGGAACGAAAAGTATTCCGTTTG
AGGCAGCGGCTGTATGAGGTTCTCCTTGACCTCGGCGACCAGGTAGACATAGAGCTCGCTCAATTGCTTTCTCAGTCTGCAGCTCCTGAACAGGGTCACT
TGGAACCAGAGATGACTTCAGGACAGGTTGATGCTAACTCTATTGAGAGCGGTGGTGTTCAGCATCACGAATCCTATGGTTCGCCAAAGGCGAATGCAGA
CCACCAGTCGTTTCGAGATACCCAACAAGATTATGATGTCGGAGGAACAGACGACAATGAGATTGACAGCGGGGTGGACGACGAAGGCGAGGATGAGAGT
GCTGACGAACCCGACAATATCATGGAGGACGACATAGAAGGCGATGAAGATTCAGAGCACGATGAGGACCACAATTCCGAGTGTGTCGACGAGCTCATGC
TCATGGGTTTCCCAGAGGAGTGGTGCGTTTTGGCACTGAAGCAAACGGAGAGCGACATTGTTGCCGCTTCCGCGTGGATTGTAGACAACTTGGATTATCT
GAGCAAGCTGCAGATCTCATTAGACAAGAAGCGCGACGCCGAGCAGGAGTCGGAGAGGTTCAACGACGAGGACGACGACGTTGTTCAGGATGACGTGAAC
AAACTTAAGCAAGAAGCTTACGTTGCAGAGGGCAAAGACGTTCACTGTTTCGGTGATTCTCCCGACAAACCCGACAGGAACGAACTGTCATTAAATGCTG
GACATATCCAATCT