Description :
From Genome Similarity Track
Location :
Scaffold_1101:5791- 7480
Transcript NameFunction/comments
Phyag_g9494hypothetical protein PHYSODRAFT_516884

Sequence
1689 bases(100 bases per row)
CTAGGATTCGTGCTCGGCTGTGTAGTTGTAGTAAATCTTGTTCTCGTACTCCGGACCGCAGAACGGGAACTCCGTCGAGTCATCCACGGGGCTGAACAAA
CTCTTTCCGGTCGTGTAGGTCACATAGCTACCAAGCACGAAACACACCCCGGTCACAgtcacagcagcaaccttTTCGTACATGGGGATGTTTCCCCAAG
CCTTCTTGAGGTAGAAGATGATCGGCAGGAGAATGCAGTTGGTCGTGATGCAGGACGCGCCCACGAAATCCGCGAAATCCGAAAAATGGTCTTGGAAGAT
GATCGAAAGCACGACAAGGATGACAACGATAACGACGCGCAGCACGATGTACTTGATAGTGTTCTTCCCGCCACGGTACTCAGCCATTTCAATTTCCGGG
TCGTCCTTGAATTCACGCTCACTGTCAGCCACGGACACGTACGACATCTTTGAGCTGCGGCGAGGCTCTGTCTGGACAATAGCGGGCGTCACGGATTCGG
TGTAGTTGAGACCGTTCTCCATGTCCTGAGTCGGCCTCTTGTGCATGCCCAACGCCAAACGCTCTGCGAGGTAGAACGCCGGGTTGATGAGCACTGAGAA
GGCGATCGTGATGTGAAGCTGCATGAACAAGTaggccagcaccaccgttCCCCAGTTCGGGGTAAAGCCCAAAGTCGTCATGCCGGTGTCCGAGTCGGGG
TAGATCGTGAAAAGCAGGTTACCCGAAATTTGGCAGCCCACGGCTGAATACGCCGTACTAGCCAGGATCAGGAACAGGCACGATATGAAGGTCACGGTAA
CGAGCACAACGCGAGGCATGCGCGTGGGGTCActgtgctgacgctgcagatccgGGATGACAATACCAGCTCCGTATGCTAGTGCCAAGTTACCGAAACA
GCCCAGCACTTGAGAGACCTTAAGGTCAGGCGACGGCACCGAAGGGTGGCCTCGCATGCCGTGCATGACCACTGCCACGCCGAGGACGTCGGCTAGGATC
GTGCCCAAGCAGCCGGCGAAggctgcaccagctccttccttCAGAGTCGGGATAAGGCACACCGGTAGCACCATGAGTGCCATGAGGATGATCCACGTAG
TGGCACTGAAGGCTTTCGGGAACAGCCCGTCAAGCAGCGAGCCAccgagcaccaagaagacgcacgGAATGAGCAGACATGAGCCCATTTGCGAGATGAT
GCAGAGCACACGACCGGTCTTGCCCATGCTCCATTCACCCAAGTCACCGAAAGTCTTGACGGACTTGGGGGCGAGCAGGATCACTTGTGACATCTTGACG
GACGCGTAGATATTGGCGAACGCCATGAAGGCCATGGCGATGACCGCGATAAAAGGGCCTGCGCGCGAGAAATTGCCGGGCATTCCGAGCGTTCCAATGC
CgtacatgcagcagaagagatTGAAGGACGTCTTTGCGTcctcgaaggtgaagaacgGCATCTTGGTCAGCTGATGAGGAGACTTGAGCCGGATGAAGTC
AAATGCAGAATGAAAGACGCAATGGCACCGGCGGGTCAAACGCCGCCGCCAGGATAAGAGCATGCCTCGTTCAATGACGTTCAATGATAGTATGCCGCCG
GCTGGAGCGCGGTATCAGCATGCTGTGTTGCACCTTGACGTTGTACTCAGGGTGATGGACGCCTCGCCCAACTAGCAAAAAGCATGCAC