Description :
From Genome Similarity Track
Location :
Scaffold_1092:579- 4154
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1092-fgenesh-gene-0.0Phospholipid-transporting ATPase

Sequence
3575 bases(100 bases per row)
TGCAGTCGCCGCGGCAGCTCAAGGGCGACTACCGCATCGTGCACCTCAACGAACCGCATAAGAACACGGAGCTTGGCTACTGCGACAACTTCATCATCAC
GTCCAAGTACACCGTGATATCGTTTCTGCCGAAATTCCTCTTTGAGACCTTCCGCAAGCTTGCCAACCTCTATTTCCTTGCGATCTGCATCATGCAGTGC
ATCCCGACGATTAGCAACACGAACGGACAGCCGTCGACACTGCCACCACTGGCATTCATCATCTTCGTTGACGCCGTGTTCGCAGTGCTCGAAGACCACA
AGCGCCACATCGCAGACAACGTCGCCAATTCGCGTCCGACCAACGTGTTTGATGCCTCATCGAAGGTTTTTATCGCAAAGCACTGGGCTGATGTTGTCGT
GGGAGACATCATCCGCCTCAACAACCGCGATCTCGTACCAGCCGACATCCTCGTGCTTGCAGTCAGCGAACTGCCCGACGCGCCGCCCTCGGGGATCTGC
TACGTCGAGACTAAGTCGCTCGACGGCGAGACCAACATGAAAGTGCGCTCTGCGATGGAATCCACGCTCGCCGAGATGGGCTCGATCGACAATTTGCTCA
AAGCGAAGGGCGTGGTCCGCTGCGAGCATCCAAACAACGCAATCAACAGTTTCCAGGGTATACTAGAGCTGGCCGGCAAGGAGAAGCAGTCGATTCCGTA
CGAGAGCATTATTCTGCGCGGGTGCATCATTCGCAACACCGACTGGGTGCACGGCGTCGTCCTCAACACGGGCAAGGACACCAAGATCATGATGAGCAAC
TCGGCGCCACCCTCCAAAATGAGCACCATGGACCAGTCCATCAACCGGTACATCGCTGCGCTGCTGGTGATCCTGGTGTTGTTCAGTGCAGTTGGAGCCT
CTGGCGCTGTGATCTGGAAGTCTGCGAGCCACAAGCCGTGGTACTTGGCGCTGGGTGAATCGGGAAACAGCAAAGGCATCGACTGGATCATCATGCTCTT
CTACTACATGCTGTTGATGTACCAGTTCGTGCCCATCTCGCTCTGCGTGTCCATGAGCATGGTGAAATACCTCCAGGCGCAGTTCATCCAGTGGGATAAG
CAGATCTACCACGACGCCACCGACACGCCCACGCTTGTGCGTTCCATGTCGCTCAACGAAGAGCTCGGACAGATCTCCTACGTGTTCTCGGACAAGACTG
GGACGCTCACGTGCAACGTGATGGAGTTTCGCAAATGCTCGATCGGCGGCGTCTCGTATGGCAAAGGCACGACTGAGATTGGTCTCGCGGCAATGAAGCG
CGCGGGCAAGCCACTTCCCGTGATGGATTCGCAGCAAGGCGGGAAGATCGTTCCGTACGTCAATTTCGACGGACCGGAGCTCTTCGACGACATGAAAGGG
AACTCCGGCGCTGCTCAACAGCGTCGCATCGACGCGTTCTTCACGCACTTGGCGATCTGCCACACAGTGATCCCGGAGCGGCGAGAAAACTCGACCGAGG
TCACGCTCTCCGCATCTTCTCCAGATGAACAGGCGCTGGTCGCTGGTGCTGGATTCTTTGGCTTCGAGTTCATGAACCGCTCGCCAGGGGTGGCGCACGC
CAAGATCCATGGAACCAACCACCAGTTTGAGCTCCTCGATATCTTGGAGTTCAACAGTACTCGCAAGCGCATGACCACGATCGTGCGCCATCCGGACGGG
AAAGTGTATCTCTACACAAAAGGAGCCGACGCGATCATCTTTGCGCGCATGGCCAAGGGCAACAACAGCGAGTCGGCTCAGCTGCAGGACATTACACGCC
GCCACATTGACGCGTACGCTGAAGAAGGGCTGCGTACGCTCACGATCGCGATTCGCGAGCTCGACCCGACGTACTATGAGCAGTGGGCGATCCGATTCCA
CGAAGCGCAGAACAACTTGGCAGAGATTGACAAGCGCAAGAAGGACCTTCCCAACGCCATCGACGACTGCATGGACGAGATCGAGAGTGAGCTGGAGCTT
CTCGGTGCGACCGCGATCGAAGACAAGTTGCAGAGCGGCGTGCCCGACACCATTGCGAATCTCGCGTGCGCTGGCATCAAGATCTGGGTACTCACGGGCG
ACAAGGAGGAGACCGCGATCAACATCGGCTTTGCCTGCCAGCTGCTGACGAACGACATGACGGTTCATATCATCAGCGCCAAGTATTTTCCAACACCAGA
GCTCATCGAAGCCGAGCTCACGGCACAGATCACAGCGCGTAGTGCCGACGTACAGAGGTATCTCGAGTCCCCCGTGGCGAGTCGCGGTGAACTCAAGAGT
ATCGCGCTCGTGATCGATGGCGAGACGCTCATCCATGCACTGACCGGGATGTGCCGCTCACTGCTCGCCGAGTTCTCGCAATACTGCAAGGCCGTCATCG
CGTGCCGAGTCTCGCCCGCACAGAAAGCGCAGATGGTCGCGGTCATCAAGGAGTACGTGCCCGGGGTGCGCACGCTCGCGATCGGCGATGGTGCCAACGA
CGTGTCCATGATCCAGGAAGCGCACATTGGCGTGGGCATCTCGGGCCAAGAAGGGATGCAGGCAGTCAACTCGAGCGACTACGCGATCGCCCAGTTCCGC
TTCCTTGAACGCTTGCTGCTGGTGCACGGGAGGTGGAACTACCGACGCATGTCCCAGCTTGTGGTGTACATGTTCTACAAGAACATCCTCTTCACGGCCG
CACAGTACTGGTACACGCTCATGTGCGGCTTCTCGGGCCAAAAGTTCTTTCTGGAAACGGGCGTGCAACTCTACAACATCTGCATGACGTCGATCCCGAT
CATCGCGCTCTCGATCCTCGATCAGGACGTGGGCGACGACCTCGCGATGAAGTTCCCAAAGTTATACTACGTCGGTCCACGCGACGAAGATCTGAACAAA
GGTATTTTCTCGCTCTGGGTGCTGGGGGCGATCGTGGAGTCCGTGATCATCACGCTCGTCGTCGTGAACGGTGTTGAGAATGGCGGCTACAGCGGCAGCA
GCAGCTCCATGTGGCTCGACGGCAGCATCACCTTCACCATGGTGGTGCTGGTCGCCAACGCGAAGCTCATGCTCTTCCAGAACAGCTTCCACTTGTTCAA
CCACGTGCTCTACTGGGGCTCGATCATCATGTGGCTGCTCGTGGCGTTCTTCGCGGGCCACGTCACGATGCTCTCGGATCTCACGTGGGAGAAGATGCTC
GAGCAAATGTTCAAGGCCAATGGCTTTTGGGCGCTTTTGCTCTTCACACCGATCGCTGCGCTCTCGTACGCATACCTGATCAACGGACTCAAGCTCACGT
TCGCTCCCGAGTACTGGCAGCTCGCAAAGGAAGTGATCAAGTTCGACCTCAACAAGCAGCTTCTCCAGTGGGACGACAACACGAACGCGTCCGTGCCGGT
GCCGGTCAAACCAGCGCGCGGCAGATCGAAAGGACGTCTCGGACTCGTCGTACCGACAAACGCAAAGAGCTCGGCAGTTTGGAATATTCTCCAACGCCCG
CATCGCGGATTCGCATTCTCGACGGACTCGCACGCTCACGCGGAAGAAGCCCACATGACAATGACCGGCGCTTCA