Description :
From Genome Similarity Track
Location :
scaffold_132:57897- 62622
Transcript NameFunction/comments
g4291.t1hypothetical protein
g4292.t1 T-complex protein 1 subunit theta
g4293.t1 hypothetical protein PHYSODRAFT_344278
g4294.t1 ATP-dependent RNA helicase DHX8

Sequence
4725 bases(100 bases per row)
TGGGGTTGCGACGTGTGCCAAACGTCTTCGTCTTCGATTCTGTCACTTTCTCAGCCTCTTCAACTTCATCACCACTTTCATCTTTCTTCTCCTGCTTGGG
CTCTTCCTTCTCATCCTTCTTCTCCTGGTTGTGCTCTTCTTTCTCATCTTCGGAATCGCTCTCGTCCTTCACTGACTCCTCGTCCGGCTCTTCGTGTTGC
ACCGGCACAACTTCCACTTTTTCTTCAGGTTCTGCAGCAGCTAGAACACTCTTTGATGGTTGAGGCTTCGCCTGTGGCTTACTAGTACTAGTCACTGTCT
TGTGCTGGTTATTGCCATCACTAGCATGCGGTCGCTGTCCTCCAGACTGCTTTTGAGGCACTTTTCCGGTCTTATTGGCCTTCGCCTTCGCGCGCTTGGC
CTGCTGCTTAGCACGGAAGGTGTTCTTCTTCTTTACAGGCTTCCGCGCGCCGCTGGACGCCGAGATGTTGAGCGAGAAGGCCTCCATGACTGCGGATGGC
TGCTCACCGATTGTACTGCTGGTCACGAAGCTCTGTTACCTTCAAATCTTCTGTGATTGGTTGAAATGCGCTTTTTGATTTCGTCCAATAGACAAGAAGT
ATCTCTTGTGTGGCGCCACGCCAGAAGGGGAATCTTTGACACCAAGCAAAAGCCACCAGCCAAAGCCAAGCAGCAAGCATGTCCAAGTCGATGGGACTGA
ACGTGGCCGGGGGGCTCTCCTCGATGCTCAAGGACGGCCACAAGCACTTCGAGGGAGTGGATGAGGCCGTGGCCAAGAACATCGACGCCGTGAAGCAGCT
GGCGGCCATCACGCGCTCGTCGCTCGGCCCTAACGGCATGAACAAGCTCGTGATCAACCATTTGGAGCGCATCTTCGTCACGAGCGACACTGCTACTATT
GTCAAGGAGCTGGAGGTCATCCACCCGGCCGCACGCATGGTCGTCATGGCCGCCAAGATGCAGGAGAACGACTTTGGAGATGGCACGTGCCTTGTGGTGG
CTTTGGCCGGAGAACTGCTCATGGAAGCCGCTAGTCTGCTGCGTATGGGTCTGCACGCCAGTGAAATTGTTACTGGATACCAGAAGGCACACGACAAGTG
CCAGGAAATCCTGCAGAAGCTGCAGAGCGTGCAGGTAAAGGACCCGCGCGACCAGGAAGAACTGCAGAAGGCCATTAAGACGTCGCTGGCCTCCAAGCAG
TACGGATACGAGGATTTGTTGGCCAAGCTCGTCGCTGAGGCCTGTCTTAATGTCATGCCTGCGGCTCCCAAGAAGCCGTCCATTAATGTGGACAACATTC
GTGTGGCAAAGATCATGGGTGGCAACTTGAACGACTCGACGGTTATCCGCGGCATGGTCATTCAGCGCAACACTGAAGGAAACGTGAAGAAGGCGCTGAA
GGCTAAGGTCGCAGTGTTCGGCTGTGGTATTGAGATTTCGTCCACGGAAGCCAAGAGCACCGTGCTTATTAAGGACGCTGATGAGCTCATGAACTACAAC
AAGGGCGAGGAGAAGCACCTGGAAGAGGCTGTCCGCGCTATTAGTGAGTCGGGTGCTACGGTGGTCGTCTCTGGCGGCAGCATCAGTGAGATGGCGCTGC
ACTTCTTGGAGAAGTACAACCTTATGGCTGTGAAGATCCAGTCCAAGTGGGAACTGCGTCGTCTGTGCCGTGCTGTGAATGCTAACGCACTGGTGCGTCT
GGGCGCTCCCACGCCCGATGAGATGGGTTTCTGCGACAGTGTGACGGTCAAGGAGATCGGTGGCAAGAAGGTGACTGTCTTCCAGCAGCAGGAGGAGGAC
GCCAAGATCTCGACGATTGTGCTGCGTGCCAGCACGGACAACGTTCTGAACGACATTGAGCGTGCCATCGATGACGGCGTGAACTGTGTGAAGTCTGTGT
GCCGGGACGGCCGATTCGTGTCTGGTGCCGGCTCCACGGAGATTGAGCTGTCGCGTCAGATCAAGAGCTTCGGTGAGGCCACGCCTGGTCTTGACCAGTA
CGCCATTAAGAAGTTCGGTGACGCTATTGAGGTTGTTCCCCGTATTCTGGCTGAGAACTCGGGCCAAATGGCCACGGAGGTTATCTCTAGCCTGTACGCC
GCTCACGCGGCAGGAAATGTTAGCGCTGGTGTGGATGTGGATGTAAGTGCATTCTGTTGCTGTGTGGGATTTGATTGAAGCTTGTACTGACTTGTTGTTG
ACGTGTCATTGCTGTGTTAACAGAACGAGCACGAATCGCACGTAATTCTGGACGCTCTGGACAAGGGTGTCTGGGACCACCTCCAGACTAAAATGTCCGC
TATTCGCCTCGGTGCTGACGCTGCCATCACAGTGCTCCGTGTGGACCAGATCATCATGGCCAAGGCAGCTGGTGGACCTAAGCCGCGAGGCATGTAAGGA
AGCGCGATATGATATCTCCTGCGGTTGCAGCTAGATTCGCTTTTTTCCTTCGTTTCTTCGCTCAGGTAGTTTATTCAATATCGAAATGAAGCCTTCATCT
CTCACACGTGTAGAACAGCAGCAAAAGTCTTTGAAGAAGTCATGGGCAAAATGGCGAGGTGGGCCTCGCCCTCATATTCGATTAGTGAAAGATTTAGCAA
GTCTGTGCAAATCTTCGCACTGCTCGCTGCTTCTTACCGCTCGTCATTTAAACACACAACCTAAACGCACAGTTTGCTCCTTCTCTCGAGCTCGAGCCTC
TCTTTCGTCTCCAATAAATCATTCATACAGCTCACTTCTTGCGCGAGATGCCAGCAGGCCGAGAATTAGGAAGCAATCTCATCAGTGGAGCTACAACCGT
TGCTGTAGCTGTTGCTGAGGGCCTTCGAGCTCAACGACCCTCCTCTTCAGAGCCTCATTCTCCTCCATGAGCGTTCGAATCGTTGACTCGAACTTGCGCG
TCTTCTCCTTATTCCGCGTCGCCATCTTGATGATGCGTTCTCTCAGCTGCTGCTCCATTGAAGTGCTCTTCCCCCCAGGGTTGTGCCACAACCTGATGTG
TTTCTTGAGGCTCTTGGGACTACAAAAGGTTTTGGAGCACGTCGGGTGGTCGCAGGCGTACGGGTTGCCTTCCGCGTGGATTTTTAAGTGGAACTCGAGG
TAATCCTTGCCCTTGAAGCTCTTGGTGCAGTCCGCATACGTGCACTTGTACGGCTTGTCCCTCGAATGAGTCTGCAAGTGTCTGTAAGCAACATTCATAT
GAGCCATTATGCATCCTCTCAAGATCCGTTTAACATTTAATAAAAGCGTACCGCGTCATGGCAGATTTCTCGGCGAAGGACTTATCGCACGATGGATACG
TGCACGGGAACGGCTTTTCACCTGTGTGCACACGAATGTGTCTGTAACAGCAGCAATAAACGTCAGATCAAGTTTATCAAAGCGCAGCTTCAGTTCTTTC
AACGATAACGTACCGGATGAGAGCCCATTTGGAGTCGAAGCTCTTACCGCACTCGGGCGTCTGGCACACATGGCGTTTCTGCTGCCATTTTTCCCTCGAG
GACACGGACGACGGCGCTGGTGACGCCGGGTCAGGGCCAAGCTTGATGTCTTGCAGCATGTGCGCTGGAGACGCCGGGTCGGGACAAAACTTGACGTCGT
GCAGCAAGTCTCCTGCGGTGGTCATGGTCAAGCCCATGTTGGTGTTGACTGGCGGCGGCAGAGGCACGACTGCCATCGCATGCAGATCCATGTCCGCAGG
AATATACGCTCCTGCCATCGCCAGGTGCTGCTGGTTGGTGTCCATGGCTGCACGGTCGAATACTTGGAACTGAATATACCGCAGACCCTTGTATATGGAG
GCGCTCCCAGTGTGAATCGCCGCGATCACGAAGGCAAGTTGAACTTTTGAACGGCTTTTTTGTGATTGGTCGATATTCGTACTGTAAAACAACTGCGATC
TAACCCATCCCCGGAATGTTTGGTGTACGTCACACCAAAGTGGCAGCTCCCTTCCAGTGACAATCACTCTGCTGAACACGTTACTGGAGCAAATAGGTGA
AAGGATGGAGAAGCTGCAGGAGCTGAGTCTCGTGTCCAAGGTGTGCCAGGCGCTGGAGAACCACCTGGGCATGAGTGACAAGACGCTGGCCGAGTTCGTG
ATCGACCTGGTGCGCGGTAGTTCAAGCTGCGCTGCCTTCCTGGCGTCCATCAAGAAGGATGAGCTGCCGCTGCCACCCGCGCTGGCTGAGAACCTCTACA
GAATCGTACAGGCCATGGCGCCGAACAAGATGAAGCAGACCAAGGATGCCAGTGCTGGAGGCAAGAACAAGATCAAGAAGCACCAGATCCGAGAAGACGA
GCAGCTCACAGCGTCGGATATTGCTGGTGCGTCCATTAAATACGACGAGGACGAGAAGAAGCCGACGTCTTCTGGTCGCCATGATAGGGAGAGTGATGGA
CAATCTCGAACCAGAGGCAGATCAAGGGAACGTGATCACTACGGACGGGACAGGAATCGCGGACGGGAGGACGATCGAGGCAGGAGAAACAGGCGGTCGA
GGTCCAGATCGCGCTCGGAAGGAAGGAGAAGTGATCGACGAGACAGGGAGAGAGAACGTAGCCGGGGGCGTGATCGGGACGATCGCTATGGGTCGTCTCG
CTCCCGGCGTGATGATCGCGATCGAGACTACGACAGACGCGAAAGAGATAGCCAGCCAAGAGAGTTGGAGCTGTATGGCATCTATGATGGCCGCGTGGCG
AAGGTTATGGACTTTGGTGTGTTTG