Description :
From Genome Similarity Track
Location :
contig_42:578935- 583769
Transcript NameFunction/comments
g9141.t1OWZ08073.1 hypothetical protein PHMEG_00019443 [Phytophthora megakarya
g9142.t1POM64021.1 Cmp dcmp deaminase family [Phytophthora palmivora var. palmivora

Sequence
4834 bases(100 bases per row)
GCGCTCCGCTGTCGGGGCGTTTGACTCGGACGGCGAGAAGAAGTCATACCCTTGACGCTCCGGCATTGTTGCAGCTGATTCCGTGCTTGCTGGAGAGATG
AAACTCGAGTCCACCCGACGCTCTTGACCTCCTTCTCCTTTGTTTCGTGCATCCCCACCCAGCCAGCGCTGAACTCGATCCATCGTGAGCAGCTTGACGA
AGGATTCCTCACTGAGGCTGGCCGTTAGGCATCGCACCCTACCCGATATCACTCGGCGGTGTTGCTCTCGTTCTTCGGCACTGAGCTCAAACCATAAACG
CCCTCCCTCCCGTCGACGATCCTCATCAAACTTCTGCACAAACAGCACAAAGTTGCGGATCTGGTTCTTCATGCGATTGACCGCCGTGGAGGAGCGAACG
AATGAGCTCCGCCGTGAAAACAGAGCGTATACCTTGGCGTGAAGCGTCCCCGTACCTCGCTGGCAGCGCAGCGTAGGGTACTTCGCCTCCACGTCGCTCC
ACGCCTGAACGAGGACGTCGACTTCGCTCCTAGTCCACGAGGTTACGTTCGACATCGGAGCTCGATCTGCGAATTCCTAACTGGCGGGTGCCTCGACACG
GAAATTGACGGCGTGCTGCACCGTCCCAAGCGTAGGAAGTCAAGTCGGAATAAAGGTCATATTAGAGGATGGCAGCAAGCAGCGCCTCGTGCGCTTGATA
CCCTTATGAACGCACCAGTCCTTCCCAATGGTTACTGATCGTTACGATCTCGACCGGGAGCAGAGTTGCCGTAGCAGCGCATGGAAGTCCTCTCTCTCCT
GCTGTCGCTCCGTGTGCATCTGCGCGAATAAATCCATGAATTGCTCCTGCTGCTTGCCTACCAGTGACTCCATGAAGGGCACGTTCTGCTGAGGGTCTTC
AGGTGGCGTGCGCTGGTGCAAGATGTCCAGTAGCATCGCTTGGTTCTGCTTGCGTTCCTCCATTCGCTCCTCTCTGAGATCGTGCATGAGCTGCTCGAAG
CGTGCGTTTTGTGCCTCGAGAAGCGACTCGACCACCTTCTCGTCTACTTGAGGCTCCTCGTCTTCATAGACAGAAGGAGGTGGCAGTGTGGCGGGGAGAA
GAACGTCCTCCGGGTCGGACACTTCATCGTCGTCATGGGACGGAGAGAGGCTGGGGGAAATGGCCGGCGAGTCCTCCGACAATGCCTCGGACGACACCGA
CGGTTTCCGCGCCTTCTTCGGGGTCCGCTTCCGCTTCCGGCCTGTGATCGCCGCTAGCACCTCCTCCTTCTCGATGATGACGCCGATTTTGTGGTACGTC
TGTCGGTCGATCTCGCAGCCCACGCGTTGGCTCGACTTGGGGCTCACCAGTTTCCGCTGGAGACGGAACCGCTCGTCGAAAGTGAGCTCGAACCAGTCTG
ATCCGTCAAGAGCCTCCAGTCCGACCACGCAGCGCGTGATGAAATGGTAGGACTGGATGATACACCGTCTCTTGGCTGTGATGGACCCGACCGTCGTCTC
GCTCGATCCCCCCATCGCAACGAACTTCTGTCGAATCAACCAGTTGGGCAGCTTGACCGTCTCACTCGGTTCGTTTCCGAGGTCGAGGAACTCGTCCACT
GCGTCTTGCCACGCGTCCACGAACAGCGCCCAGTCTTGGGTGGTCCACGGCTTGGGGGCGTCCTCCACCGCCTCCTCCATCTCGGTTCCGTGTCGTTCTT
CTTGCGCTTGGGTTTCACCACCTTTTGCTTCAAGGACCCACCCCCTTTCCCCCCACAGACGTGGTCGAGTTGGCGGAAGAGCTCGGGACTCACGACCGTC
ATGCCCTTCTCCTTCTTGTTGGTCGCCCGACGCAGCTCGTGCTGCTCGGCCGCCGGGAGTTCAAACCACGAGGGGGACCCCGTCCGCCGACTTTTCCGGT
TCGTGTCCACGATGAGGCGGTACGACATGCACAGGCGGTGGTGCTGCCGGGTGACCGACGACAAGCTCCGTTTACTGCCGCCCGAGAGAGCGCAGAACCG
CGCGTGCAGCGTGGAGCGCTCCCCCGTGGACAGAATGAGTCGGTCCTTGGGGTCGTCCACGACTTCTTCCCAGGCTTGAACCAGTTGCGACAACTCGTCT
TTGCTCCACGCCGCATTGACTCTGGCGGTCGAGCTTAGTGTCGACATGTTGCCCACTCGATTGGGCCCTTGACGAGGTGCTGGGGGCGCTCGGGGACGCT
CTGTAGCGCTCAGGGGCGTGCAGAGGTCGGTTTCCAGCCGTCGAATTGAGATTTCGAGGACTGTCGCGCTCACTGGCTGGGGATTTGTCGAAAACTGGAC
GGAATCACTTGGTGTTTGTATGGCTTCCAAACTTTATACCCGAAATTTGCCGGAGAAGGTGGTGCAACATCGAAATTCAAGCGCTACTTTGGTTTACCCA
ATTCATGCAAACTGCAACTATACTTGCTCGGTCACTCCTTGTGCTCCTGGTCCTGGCTGCCCACGAGGCGAGGCCCACCCAATTCTCGCAGCAGCATCCG
AGCTTGCTCGCGCTCCTGCGACCGCTCGTCCTGCAGCTGGTTGAACAGCCCCAGCATGTGCTGGCGCTGCTTCTCCACCAGCGCTTCCACGAACGGAGCC
GGTTGATCGGATTTCTGGGCCGACGCACTGCGCAGCTTGAGCGCCTCGAGGATGATCTCCATGTTGTGCTGGCGCTCTTGTCGCCGCTCCTCCTGGAATT
CCGCGAGAAGTGCCTCGAACCGCTGGGTCTGACCGTCCAGCAACCGCGACACCCACTTGGCGTCACTCACCCCCGTACGACGGCGCTTAGGAGGCGAGCC
ACCGCTACTTGCAACGTCGGCAGGGTTCACCTCGCGACTAGATCTCCGCGCTCCGTTCTTTGCAGAATGAGGACGTCTAGACACCACCAGGGCCTGTGAA
TTTGCTCCTCGACTTGAATTTTCACCCCTGCCATTTCGAGCAGGTGCAGCCCAGTCGGAGGTCTCATCTTCCGACTCGGACGTTCTTTCTGCAACCACAA
AGCCACGAGGAGGGCCACCGGCATACTTTCCCTTGCCTAACTTCTTGCCTACCTTTTTCCGAGGATCCCTCGCACCTTTTGCCGTTCGTCCAAGAAGCTC
ATCTAGAGTCACCGGGGCGCGCAGTGCACTGGCCACCGGCGTTGAAATCGCTCGCTGCGCCCGGTCAATCTCGCCAAGTCGCTGATACACCTCTTTCTCA
ATATAACACGCGTGCTCGTGGTGGTGTCCGTGCATCTTCTGCAGTTCCATCCTCTCGTCGGGTGTCATGCCAAACCAGTTGGGGCGCTCACTCAGCGACG
CCAGCGTGCGGAGCACTCCACGCAGCGACCGGAACGCCATCATGATGGCGTGTTTCTTGGCGCCGGTTGACTGGTTGGTGCGTGGCGTTTTGTCTCCGCA
CAACTCCACATACCGCTGGTGAATCAGCGAGTTCAACCGCAGGCCCTCGTTCCGCGACGCGAAAGAACCTTCATACCCGTTATCAATCAACGTCGTCACG
ACCCCATGCCAGGCCGACATGAGGAGTTGTTCGTCTCGTTTCGACCACTTGGACGTCGCCTTCCCCTTGGCTTTCCCCTTTGCTTTGGGCGGGGTGTAGT
CCAGGTCACTGTCCTTGCGGCTTCTCTTGGTCGGTGCGTACTCCTCCTCCACCGACTCTTCGTCCGATTCGGACGTCGCTTCCCTCTTTGTCTCCACCTC
AATCTGCTTAGTGTTTGTCGTCCGAACGGGGGACGACGGAGGTGACAGCGACGGTGACAACGTCGGTGGCGCCTCGTTGTTGGCCCGGAACATGGGCAGC
CCCGCCAATGCCTCGGCCGCCGCCTTCATCTCGTCGGCCATTGGGGGCGACTGCAACTGCTCCGGGGGTTCGCAGATCCGCGCAAGGTACTGGAACTCGT
CCTGCGTCACTTCCGCGAGGTCCCCGAGGCGCCCGTTCATGCGGCGCAGGTCGTCCTGTTGCTGCGGCGGCAGCTGGAACCACGTGGGACGGCCGGCGCG
CGCGCTCTCGGCGTTGAATGCGCGCAGGAACAGGAAGGTGCGCACGAGTCGCTGGCGCTGTGCTTCCACTTCCTGGATGGCGATGGGTGCGCCGTCCCGC
GGACGCAACGCGTCGAACCGCGCGAGCACCTGCTGCAACTCGTCGTCCGTGAGTTCGTCGCGGTCGCGAGGAGCCGCTATCGCCTGCTCCCACGCCTGCA
GCAGCGCGAGCAACTCGTCTCGTCGCCACTGGACCATGTTCGTTCGACTTTGGTTTCTCTCGCCTGAATCCTAAGCTCTCGATGGTTTATTTATTTATAT
GGCGAGTTGTATGAGACTTTAATTGACTTTTCGAAGGTACTGGCAGTTTTTAAGAGCTTGCTGTGACTTTTTGACTGGCGATGGGAGATACTGCGAGTAT
CGTGCAGGTGTTCGACGAGGGCGAAGTGGACAGAGTGGAGGAGTCCATCCGCGTGCGCGTGTACGACCAGGACCTGAACTTGACCCTGCTCATGGTACAA
ACTTCGTCAAAAATGCCCGTCGCCATGTCTGACTTGTACGACCACTTCAATGTTCATTGCTACAGCAAGCGGATGAGCTCGCTCCGTTATTTTCCGGCGC
CGCGTGGGCCGGCACGTTGCTGTGGGACGCCGCTGTGCACTTGACGAGGCGGTTTCTGGTCGAATATCGCCAGGAATTGGCGTCTTCGACCAATTCGCTG
CGTGTTTTGGAACTCGGTGCCGGCATGTGCGTAGATGCTTGTCACTTGTTGAGAAAGCGGTGCTGACAATGGTGAGTTGGTGACGTTTTGACGCAGTGGC
GTGCCCGGTATGGCGGCGCGTGTTGCAGGGGCCA