Description :
From Genome Similarity Track
Location :
contig_42:578924- 583758
Transcript NameFunction/comments
g9585.t1XP_009524505.1 hypothetical protein PHYSODRAFT_329696 [Phytophthora sojae
g9586.t1XP_008915761.1 hypothetical protein PPTG_19161 [Phytophthora parasitica INRA-310
g9587.t1XP_009524503.1 hypothetical protein PHYSODRAFT_285654 [Phytophthora sojae
g9588.t1POM64021.1 Cmp dcmp deaminase family [Phytophthora palmivora var. palmivora

Sequence
4834 bases(100 bases per row)
TCCTCGCGCTCCGCTGTCGGGGCGTTTGACTCGGACGGTGAGAAGAAGTCATACCCTTGACGCTCCGGCATTGTTGCAGCTGATTCCGTGCTTGCTGGAG
AGATGAAACTCGAGTCCACCCGACGCTCTTGACCTCCTTCTCCTTTGTTTCGTGCATCCCCACCCAACCAGCGCTGAACTCGATCCATCGTGAGCAGCTT
GACGAAGGATTCCTCACTGAGGCTGGCCGTTAGGCATCGCACCCTACCCGATATCACTCGGCGGTGTTGCTCTCGTTCTTCGGCACTGAGCTCAAACCAT
AAACGCCCTCCCTCCCGTCGACGATCCTCATCAAACTTCTGCACAAACAGCACAAAGTTGCGGATCTGGTTCTTCATGCGATTGACCGCCGTGGAGGAGC
GAACGAATGAGCTCCGCCGTGAAAACAGAGCGTATACCTTGGCGTGAAGCGTCCCCGTACCTCGCTGGCAGCGCAGCGTAGGGTACTTCGCCTCCACGTC
GCTCCACGCCTGAACGAGGACGTCGACTTCGCTCCTAGTCCACGAGGTTACGTTCGACATCGGAGCTCGATCTGCGAATTCCTAACTGGCGGGTGCCTCG
ACACGGAAATTGACGGCGTGCTGCACCGTCCCAAGCGTAGGAAGTCAAGTCGGAATAAAGGTCATATTAGAGGATGGCAGCAAGCAGCGCCTCGTGCGCT
TGATACCCTTATGAACGCACCAGTCCTTCCCAATGGTTACTGATCGTTACGATCTCGACCGGGAGCAGAGTTGCCGTAGCAGCGCATGGAAGTCCTCTCT
CTCCTGCTGTCGCTCCGTGTGCATCTGCGCGAATAAATCCATGAATTGCTCCTGCTGCTTGCCTACCAGTGACTCCATGAAGGGCACGTTCTGCTGAGGG
TCTTCAGGTGGCGTGCGCTGGTGCAAGATGTCCAGTAGCATCGCTTGGTTCTGCTTGCGTTCCTCCATTCGCTCCTCTCTGAGATCGTGCATGAGCTGCT
CGAAGCGTGCGTTTTGTGCCTCGAGAAGCGACTCGACCACCTTCTCGTCTACTTGAGGCTCCTCGTCTTCATAGACAGAAGGAGGTGGCAGTGTGGCGGG
GAGAAGAACGTCCTCCGGGTCGGACACTTCATCGTCGTCATGGGACGGAGAGAGGCTGGGGGAAATGGCCGGCGAGTCCTCCGACAATGCCTCGGACGAC
ACCGACGGTTTCCGCGCCTTCTTCGGGGTCCGCTTCCGCTTCCGGCCTGTGATCGCCGCTAGCACCTCCTCCTTCTCGATGATGACGCCGATTTTGTGGT
ACGTCTGTCGGTCGATCTCGCAGCCCACGCGTTGGCTCGACTTGGGGCTCACCAGTTTCCGCTGGAGACGGAACCGCTCGTCGAAAGTGAGCTCGAACCA
GTCTGATCCGTCAAGAGCCTCCAGTCCGACCACGCAGCGCGTGATGAAATGGTAGGACTGGATGATACACCGTCTCTTGGCTGTGATGGACCCGACCGTC
GTCTCGCTCGATCCCCCCATCGCAACGAACTTCTGTCGAATCAACCAGTTGGGCAGCTTGACCGTCTCACTCGGTTCGTTTCCGAGGTCGAGGAACTCGT
CCACTGCGTCTTGCCACGCGTCCACGAACAGCGCCCAGTCTTGGGTGGTCCACGGCTTGGGGGCGTCCTCCACCGCCTCCTCCATCTCGGTTCCGTGTCG
TTCTTCTTGCGCTTGGGTTTCACCACCTTTTGCTTCAAGGACCCACCCCCTTTCCCCCCACAGACGTGGTCGAGTTGGCGGAAGAGCTCGGGACTCACGA
CCGTCATGCCCTTCTCCTTCTTGTTGGTCGCCCGACGCAGCTCGTGCTGCTCGGCCGCCGGGAGTTCAAACCACGAGGGGGACCCCGTCCGCCGACTTTT
CTGGTTCGTGTCCACGATGAGGCGGTACGACATGCACAGGCGGTGGTGCTGTCGGGTGACCGACGACAAGCTCCGTTTACTGCCGCCCGAGAGAGCGCAG
AACCGCGCGTGCAGCGTGGAGCGCTCCCCCGTGGACAGAATGAGTCGGTCCTTGGGGTCGTCCACGACTTCTTCCCAGGCTTGAACCAGTTGCGACAACT
CGTCTTTGCTCCACGCCGCATTGACTCTGGCGGTCGAGCTTAGTGTCGACATGTTGCCCACTCAATTGGGCCCTTGACGAGGTGCTGGGGGCGCTCGGGG
ACGCTCTGTAGCGCTCAGGGGCGTGCAGAGGTCGGTTTCCAGCCGTCGAATTGAGATTTCGAGGACTGTCGCGCTCACTGGCTGGGGATTTGTCGAAAAC
TGGACGGAATCACTTGGTGTTTGTATGGCTTCCAAACTTTATACCCGAAATTTGCCGGAGAAGGTGGTGCAACATCGAAATTCAAGCGCTACTTTGGTTT
ACCCAATTCATGCAAACTGCAACTATACTTGCTCGGTCACTCCTTGTGCTCCTGGTCCTGGCTGCCCACGAGGCGAGGCCCACCCAATTCTCGCAGCAGC
ATCCGAGCTTGCTCGCGCTCCTGCGACCGCTCGTCCTGCAGCTGGTTGAACAGCCCCAGCATGTGCTGGCGCTGCTTCTCCACCAGCGCTTCCACGAACG
GAGCCGGTTGATCGGATTTCTGGGCCGACGCACTGCGCAGCTTGAGCGCCTCGAGGATGATCTCCATGTTGTGCTGGCGCTCTTGTCGCCGCTCCTCCTG
GAATTCCGCGAGAAGTGCCTCGAACCGCTGGGTCTGACCGTCCAGCAACCGCGACACCCACTTGGCGTCACTCACCCCCGTACGACGGCGCTTAGGAGGC
GAGCCACCGCTACTTGCAACGTCGGCAGGGTTCACCTCGCGACTAGATCTCCGCGCTCCGTTCTTTGCAGAATGAGGACGTCTAGACACCACCAGGGCCT
GTGAATTTGCTCCTCGACTTGAATTTTCACCCCTGCCATTTCGAGCAGGTGCAGCCCAGTCGGAGGTCTCATCTTCCGACTCGGACGTTCTTTCTGCAAC
CACAAAGCCACGAGGAGGGCCACCGGCATACTTTCCCTTGCCTAACTTCTTGCCTACCTTTTTCCGAGGATCCCTCGCACCTTTTGCCGTTCGTCCAAGA
AGCTCATCTAGAGTCACCGGGGCGCGCAGTGCACTGGCCACCGGCGTTGAAATCGCTCGCTGCGCCCGGTCAATCTCGCCAAGTCGCTGATACACCTCTT
TCTCAATATAACACGCGTGCTCGTGGTGGTGTCCGTGCATCTTCTGCAGTTCCATCCTCTCGTCGGGTGTCATGCCAAACCAGTTGGGGCGCTCACTCAG
CGACGCCAGCGTGCGGAGCACTCCACGCAGCGACCGGAACGCCATCATGATGGCGTGTTTCTTGGCGCCGGTTGACTGGTTGGTGCGTGGCGTTTTGTCT
CCGCACAACTCCACATACCGCTGGTGAATCAGCGAGTTCAACCGCAGGCCCTCGTTCCGCGACGCGAAAGAACCTTCATACCCGTTATCAATCAACGTCG
TCACGACCCCATGCCAGGCCGACATGAGGAGTTGTTCGTCTCGTTTCGACCACTTGGACGTCGCCTTCCCCTTGGCTTTCCCCTTTGCTTTGGGCGGGGT
GTAGTCCAGGTCACTGTCCTTGCGGCTTCTCTTGGTCGGTGCGTACTCCTCCTCCACCGACTCTTCGTCCGATTCGGACGTCGCTTCCCTCTTTGTCTCC
ACCTCAATCTGCTTAGTGTTTGTCGTCCGAACGGGGGACGACGGAGGTGACAGCGACGGTGACAACGTCGGTGGCGCCTCGTTGTTGGCCCGGAACATGG
GCAGCCCCGCCAATGCCTCGGCCGCCGCCTTCATCTCGTCGGCCATTGGGGGCGACTGCAACTGCTCCGGGGGTTCGCAGATCCGCGCAAGGTACTGGAA
CTCGTCCTGCGTCACTTCCGCGAGGTCCCCGAGGCGCCCGTTCATGCGGCGCAGGTCGTCCTGTTGCTGCGGCGGCAGCTGGAACCACGTGGGACGGCCG
GCGCGCGCGCTCTCGGCGTTGAATGCGCGCAGGAACAGGAAGGTGCGCACGAGTCGCTGGCGCTGTGCTTCCACTTCCTGGATGGCGATGGGTGCGCCGT
CCCGCGGACGCAACGCGTCGAACCGCGCGAGCACCTGCTGCAACTCGTCGTCCGTGAGTTCGTCGCGGTCGCGAGGAGCCGCTATCGCCTGCTCCCACGC
CTGCAGCAGCGCGAGCAACTCGTCTCGTCGCCACTGGACCATGTTCGTTCGACTTTGGTTTCTCTCGCCTGAATCCTAAGCTCTCGATGGTTTATTTATT
TATATGGCGAGTTGTATGAGACTTTAATTGACTTCGAAGGTACTGGCAGTTTTTAAGAGCTTGCTGTGACTTTTTGACTGGCGATGGGAGATACTGCGAG
TATCGTGCAGGTGTTCGACGAGGGCGAAGTGGACAGAGTGGAGGAGTCCATCCGCGTGCGCGTGTACGACCAGGACCTGAACTTGACCCTGCTCATGGTA
CAAACTTCGTCAAAAATGCCCGTCGCCATGTCTGACTTGTACGACCACTTCAATGTTCATTGCTACAGCAAGCGGATGAGCTCGCTCCGTTTTTCCGGCG
CCGCGTGGGGGGCACGTTGCTGTGGGACGCCGCTGTGCACTTGACGAGGCGGTTTCTGGTCGAATATCGCCAGGAATTGGCGTCTTCGACCAATTCGCTG
CGTGTTTTGGAACTCGGTGCCGGCATGTGCGTAGATGCTTGTCACTTGTTGAGAAAGCGGTGCTGACAATGGTGAGTTGGTGACATTTTGACACAGTGGC
GTGCCCGGTATGGCGGCGCGTGTTGCAGGGGCCA