Description :
From Genome Similarity Track
Location :
Scaffold_241:57890- 63499
Sequence
5609 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTCCAAGGACCACAACACCCGTTCAACATGAACATGTTGGACGACAAAGGCGACGGCACCTGTCACGACA
CCCGTGAAAGTTATTCCTATTTGAGCGACGTCGAATGGAGTGCGGTCGAACGAACGAGTTCGACTGTTGGCGAAGAAGCTGTCTGGTCTCTGCTTCCTCG
AGGGATAGGGACCAACAGCATTCCATAATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCAAGCTGAAGTGGCCCTGCTGCATCAGCACGTAACCA
GCACATTGAGCTCCTGAGACAGCAACAGTCTCAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGTAC
CGGGGAGTCGAGGAAGAATCCCTGTTGAGATGGTTCCTCGAAGTGGACGATGCCATTAAGGCTTGCCACATCGAAGATGAGGAAATGCAAGTTGCATTTG
CCAAATCGAATTTGGCAGGACGTGCCAGAACTTGGGCCCTAAATCTTCAATTACACGATCCAAACGTGTTTGGACCGTTGGCGGTCTTTAAGACTCTGCT
CAGCCGAACGTTTGAGCCGCCAAGAGCTGAGTTCAGGACTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGCAC
GTTCGTTACCTTGCAAGTTGCATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTTATGGATGGTCCCGTGAGGAACC
ACCTATTCCGCATCGAGTTGAAAATGCTTGAGGAAGCAATCACAACTGCGGTGCAAGAGTACTTTAGTGTGAGACAGGCTCACACTAGCTTGACCCCCTA
TCGTCCTTCGAGAAGAGTAGAGGCGGGAGGTCCAGAACCAATGGACCTCTGCAGTGTTGATAGCGAGAGACTCGCTCTTCAAGTAGTAAGCAATTGCAAA
ATTGCAATCATTCTTCAAGCAGTAAGCAATTGCAAAAGTGCAATCGCTGTGCAAAAGTGCCTCGCGTGCAAAAGTGCCTCGCTCTTCAAGAAGTAAGCAA
TTGCAAAAGTGCAATCGCTGTCAGAAGTTAGGACACTACGCCTGCGAGTGTAGTAGTTCACGCCCAGTGTCTCGAAACACTGAGCGAAGTGATCGATCTT
CTGCCAAGAAGGGCAACGGACGCGGGTCCGACGCTATTGCGAAGTCACAACAGCGTAGCGGACCGTCAAAAAATGGTCGGGGTCAGGAGGGGCGGAGCGC
CCTACTGATCCAGCAACCTCAAGAGAATTTGCAAATCTCTTGACGAAAGTTGCTTCAGATACACAATCATTGTGTGTGTCTGCACCTGGTGGTATAGGTA
TCACTCATCACCTTGGAGTTGAAAGTGACAAATGATTTGCCACTTCGTGCCATAGTTGACTGTGGGGCGTCGAACAACTTTGTTCGTCGTCAGTCACTAG
AGTGTCGAAGGCTCAAGTTCGTTGAGCACGACATCCCTTCAACGAGGATGACGGTGTGCCTTGCCACAGGCGCTTCGATAACCGTTGGGAAACGTGTAGT
AGGAATCCATTACACGTTAGAAGATTTGGAGTACAATGATGATTTTATCGTACTTGATTTGGATGACAAATTTGATGTAATCCTAGGGTTATCCTGGCTC
ACAAAGTACGAGCCAAGGGTCAGCTGGCAGCATCGAACCGTGAAGATGTCTGCCACTTGTTCATCAAATGGCCATCTGATGAACGTCTTGGAGCGTCCAC
AAGCGTGTGGATATCCTGAGAGTGAGTGCGATGGTCTCACTTGCGGTACGGTTGTTAGTACGACTGCACAAGATCACAGTGTGACAACCAATCACACTGT
GAAGGAAGATGCCGGCGTCTGTGCGGATGCACAGGCAGCGCCGAAGGTTCACAACTCGAACAAGTCAAGTGGATCGGGACAAGGGTGTACGCCTAGCGGG
CGACATCAAAGTAAGAATAAACCTGTTGCCCACACAGGGAAACACGATGATCCTAGATCGTCTGGAGAGTCGATCGTAGATGACCTAGCTGTGGTAGCAC
AACCACATCAAGAAGACGTCGAGGGAATAAGTCCCCAGCACCCTGTGGAAAAGGGTTCCCAGAAAGAAACCGAGACATTGAATGTCTTGGTTAATGACGG
GTCAAGTGTAGTCACTTATACATTTGATCCGATCGCGCCTCTGAAGTCTACTTCGGAGATCACTCAATTGCCAACGCTAGAACCGAAACGGCTCTTGCAA
GATCTGCGTATTGGCAAGGTCAAGCAGATCTGTGTACTCGTCACGGAGGACGAGTACGTGGCCGACATTCGGTCGGCAATATTATTTGCCGAGAACGAAC
GGGTTCTCAGCAGCTCATCGATGAACGAAATTGTCCTCGATGAGAAGACTCGGATTGAGAGATACACGTCTCAATCTTGGGAGTCGCTTCAGGCAAGTCC
TCTATATAATGATTTGAGGTAATAGGAGGACGTGTTCCCTAAATCCGTACCATGCCAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTCAAA
TCGGGCTCGAAGTACTGTGTCATGAATCAATGGCCACTGCCTCGTAAACAAGTACTTGTGATCGATAAGTTCTTTGTCGATCGCTTAGCTGCGGGTCATG
TGAGGGAGTCAACTTCCCCTCACAGCTCTCTGACCTTCTGTGTGCACAAGGCCACAGGAGGATAGCGGATAGTGCACGCATTCAACATATTGAATGCTGT
ACCAGCTCAGAAGCCGATACCAAGGAAGGACGTAATCATTGATGGTATGTCAAATAGTACCATCTTTTCGTCCATGGATCTTATGGATGCCTTGTATCAG
ATTCTAATGCGTGAACGGGACATCTCGTACACAGCAGTGAGCACCCCGAGCGGCATGTTTTGAGAGTGGCCATTAATGCCTCAAGAGCTCAGTAACGCCC
CTGCCACCTTCAACAGATGTGTTACAAATCTGTTGAGACCGGTGCGAGACTTCGCACCGAGTTACTTCGACGACGTATTCGTCCATATCCGGGCTATTGG
CGGAAAGACGGACGTAGAGGTTCGTAGAACATACGTTCGTCAGATTCTTACACTTACGCGCAAGCATAAGCTGTATGCCAACCTCAAGAAGTGTACATTC
GCTGCAAGCGAAACACCACTTCTTGGGTGCATCGTGGGTAAACACGGCGTACACCCTGATTCAGAAAAGATCAAGGCGATTACCGACTGGCCTGTGCCAG
TCGACGTTAAGGGACTTAGAAAGTTCCTTGGTCTAGCGGCGTACTTACACAAGAACTCGCGCTACTACGCCGAGATGATCGTTCATCTCTCCCGTCTCTT
TAAAAAGAACGAGAAATGGTCTTGGAACGCTGATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTTGATGCAATCGCCCATCTTGGTGATTGCGGAC
CAAGACAGATCGTTTCATGTGGTCTGTGACGCCAGCGATTTCGCAATCGGCTGCGCGTTAATGCAGTACGATGCAGACGGCGCAGAGCGTGTCGTCTGTT
ATCAATCGCGTCAGCTGCAAGCAGCTGAGCGTAATTATCCAGTGCATGACAAGGAACTCCTTGCCATGAAGTATGCACTGGCGAAGTTTCGCGTCTATCT
CCTTGGAGATAGGCTGTTTGTAGTCTATACGGACCATGTGTCATTACGCACGGCCGTAAACAGCCCACACCTCTCGCAAAGGATGGCGACGTGGCTATCC
TTCTTTGCAGAGTACAACGTCTCTGTGGAGTACAAACCCGGACGACTTAATGTCGTCGCGGACGCAGTGTCGCGCCAATCCGATTTCGAGTCGGCTGTGC
AGTTCAACAGTGCGGTTGATGCCACTGTTGCAACACTAGTCACTGGTGTCCCGTCGTCAACATTGCTTGACTACATAAATAGGGCTTACGCAGAAGATAT
GGCCCTTCTGCGACTAAGGAATCATCTGGTGACTCGATCTCGTAAATCTTTCAGAGATTTACTGGCCTTGTATCAATCTTCCGCGGATCGATACACAACA
CGCAACGAGTTGCTGTATTATACAGTCGTTGCCGGCGACACACCTCATGTCGTCGTCCCCACTCATAATGATTTGCACTTGCGCATCTTGTATGAGTGCC
ATGATGCACCACCTAGTGGGCATCGTGGGCGTGAGAAGACTTATCTCACGGTAAGCCGCAACTTTTACTGTCCCTGCCAGTATCAGTTCGTGCGCAAGTA
CATTCGTGTTTATGAAGTGTGTCAACGGGTGAAGCCTAGTCCTTCATCCCGTGTCCCACTACAGCCTCTATCAATCCAGGCAGAGTGCTGGAAGTCCGTT
TCAATGGACTTCGTCTTTGGGGAAACCGAAGACGCTCACAAGAATAATGTTATTCTTGTGTTCGTAGACCGATTCAGCAAAATGGTACATCTTGCTGCAG
TTAATGAGTCAATCTCAGCACATGGTTGTGCCCGTGTCTTCATTGACACGGTATTCCGACTCCACATTGACACGGTATTCCGACTCCACGCCCGTGAACT
AGTATCTGATAGAGATCCTCGGTTCACGGCAGCGTTTTAGCAATCCGTGTTCCGATCCCTCGGAACACGTCTGAATATGTCTACTTCTGACCATCTCGAG
ACTGATGGTCAGACAGAATGCGTCAACCGCTTCCTCGAAGAGATAATTCGAAGATACGTACAATCTTTCACAGATGGAGCGTTACCGATGGTGGAGTTTG
CAATCAACAACTCTGTGCATGCATCGACAACGCATACACCATTTTTCGTGAACGGCTTACGCCATCCACGCCTACCCACCCATTAAGAGTGTGACACTAA
TTCAAGGGGGGGGGTTCGCTCGAACAAAAACCGTTCGGGCTCTTGCTCATCACGTGTCGAGGTAATCGACGATGCGAACGTTGCCGATGTCGATCAACTC
GACATTAAAGCTGATGATCTTAGCAATAGTGTCGTCACCATTGCTGACCCAGATGAAGATTACAATGCTGGTATATTCAGCATCACCAATGACTACACCA
GCGAGGATGAGAACACCCTCGCTGAAAAAGAGGATAACTTCTTAGCGGTACGCGCAAGGCGCACTGCAAAAAACTATAGTGATGCAGCAGAAGATTTTCT
GCTGACACGAGAAGCAGTGTTCCGTTTCGTGCGAGACTCCATCGCTAACGCAGCAGAACGGCAGAAACGGAACCCTGACAAACATAGAAGAGCAAAAGTT
CTTCAATTTAATGTCGGAGACTTATTTCTACTGTCTACGGTAATTCTACCTAAGCACGTAGTAACTAATGTGGGTAGTAGTTAGCTGCTACCCAAGTACA
TTGGCCCGTTCCGTGAACTACATCACAAAGGCAATGCATACACGATCGAGTTGGCTCGCAGGATGCGTACGCATCCTACGTTTTATGTCGGTCGTCTCCG
CCTTTACTATCACCACGAGGTCTTTTCCTCGGGCGAATACAACCGCCACGCTCAAGAACATCCAAGAGATTCGTTTAGACCCGAGCAAGTTTCTCAATCT
GGATCTGTA