Description :
From Genome Similarity Track
Location :
scaffold_155:57877- 59440
Transcript NameFunction/comments
g4743.t1hypothetical protein

Sequence
1563 bases(100 bases per row)
ATTTTTGAACGAGCCCGGGCCACCATGATAGCCCGGACCGCCAAATTACGGTCTTGGCATCTACGATCACATTGAAGTTGGTTTTGGACAACGCTCGATC
ACGAGAGAATTGCTACGTTGTGATATGCGGTGTCGTCATTTAACCGTCGGACCATTGTAGTGCACCAAGGAGATCACATTACGATCATATTAGATCCTCG
GAAACCAGCATTGCTATCCTGGCTTAGGAAATTCCAGACAGCTTGCATAAGTGATAAGTAGCTTAATAGACTAGTCCGAGCCTCTCTCTCTCTTAACCGT
CGGGTCGCCGCGATAACCCGGGCCACCAAATGACGATGTTGTCTTAACGGGGCTAGAGTTACCGTTACTAGCGTACACTATAGATTAAGAGGAAGCTCAC
AATAAATGAGCCTAAGTCTTAACTTTAGGGTAAATTCAACTCTGTTTTAGTATCAGGTCCAGGGCATGCAGCCCTGGCCATTCAGATCCAAGTCGACTCT
GGATTGGCTGAAATACCAACTATTTACAGTCAATCAGAGGACGACAACACAGCACGCGCTACTCGCGTGCTTCTACCTACTTTCTGCATCAAAATTTGTA
ACTCTATCTACATATGTAACTTTGGATATGGCCCGCCACACAATAACACGCGTAAATGCATGCGAGCCAACCATCGAGGTGACCGGCCCATGTAGCTTTT
GGTGTGTCCCACACACCAATGCTGGAGGTTCCTTTTTAACCTCTAACAGTTATCTTAACTGTTAGAGTTACAAGTGGTTACTGCCACTTGACGTGTAACC
CCGTTACACTATCCCCCCGTTAAGATTCGACGTATCGGTCCCGATTCGTCAATCGACAGAACTTGACCAGACGGGCAAGTCCCAGAGAGAACACCCGAGT
TCATTCCAAGATGAGTTCGCCAACGTCCTCGTCCGCAGCCACGGACGCGCAAGCCTCTCCTGCCGCCTCTGCGGCAGGAACAACAGCGGCAGTGCCTGCT
AGCGCTGCTGCTTCCAGCCATACGAGAGAGGGTAACCTCTCTCTCGGTCAATACTATGCTCTTCAGAAAGAGAAGCATGCAGTGAAACCTTGCTACGCTG
TCGACCCCAAAGAGCTCTTTGGGGACGAGGAGAATCTTATCGATTACGAGGAAGATCCTGAAGAGGGCGAGCTTGAAGACAAAGCTCCTGCCCCCGTGTC
TTCTCCTGAAGACACGCATGACCCACCCTTGGGGTCTCGACGTCCCCGTGAAGAGGCTCCGGACGCTTCCAGTTCGAAGCGTCCGCGTAGCGACGATGAA
GCGTCCCCGATGTCGAGGGCGCTCACCTCTCCGCGCACTGATTCTCCGCCAGTGCACGCACCCTGGATGCCTTCCGAGGCTGAGATCCAGGAGCGGTTCG
GTGCTAGTTGCCCACCGAACCCGATTCTGTTGTATCACGACAACAGGATCATTGACGACGAAGTCGCCAAGAACACGGTCTTTGAGTCCCCGACTCAAAG
ACGCGACTATTACATCGGACTCTTCCATGAGCTCCGATACTTCAGCGCGAAGAAGACTTCGCG