Description :
From Genome Similarity Track
Location :
Scaffold_5:578729- 582390
Transcript NameFunction/comments
Phyci_61713Hypothetical protein

Sequence
3661 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNgatcggccccaatctgtatgccgatc
gcgaaacttcccaaacctgtatgtcgatcggtgatcttccccgaacccgtatgccgatcgacgatcggcctcgatccgtatgctcgctcggtaatccgtc
ccgattggccgtcgatcctgccctgtcacggtcctactccgccgatcctgccgtttcccgcgcgtgcgtccctccagctctacacccgccggctgggtct
ggctccaaatctggtggcttctacttgttctgatcgatagtgaccacatccgatcagattccttcatcggcctgacgcccgggcgtcactgagccggatc
gtgtgtccttactcgtcttcctccttcgtcatctttcctagatctggatccgtcctgatccgagccggtgattgatgtgcatcgtccccttcgggaacct
ttcttgattgacgctttaccacagccgtcccctgtccgcaagtcgtgtcgCACAGCGGCTCACTGTGGACGTCTCCGCTTTTCTTGCTCACTCTTGGATC
TTCTACCTCCGACTCAGACTGGTCTTCGATGAGCTTCCATCAGCCCGGCGGATCGCCTGCTCGACCCTCCACCCCACCCGGGGACGAGGGATCACCTCCA
GCTTCGCCTCGATCGGCACACTCCGTCGCCACTCGTCACTCTGCTCGAAGTTCCCGCAATGGACCACGCCGGATCGCCCTCCTGGAGCAAGATCTGTAGG
CTGCATGTGCCTCGCGTGCCACGCTGATCGATGATCGGTTCCGGTTGAACGCCACCGTGAACCAGTTGACCGCGGATCTTCAACGTCTGGAGCGATACCG
CTGGGTACAAGACGAAGAAATGCGCCGCCAGGATGCCGAGATCGACGATCTCCAGCAAGGCATCAGCGTCACCGGTTCCTCGTCTACATCGCAACTGCGG
TCTCAAATCGACCAGCAGGCATAGGAGATCCAGGATCTTGACCGGCGCCTCGCACACGCCCGACAGGAATTGGAAGGGGCGTTGGCCTCCAACCGGAGCA
CGGAGCACGGAGCACGACCTCGATCTAGCAACATCGGAGATCGCTGACATGCGATCGCAGACCACGGTTCAAGTGCATGACCTGGATCTCACCCGCCACG
ATCTGGATGGTACCTCGAGTACCCTAGATCGGGTCCAAGCAGCTCTGACGGCGGCTGAATCCGCCGCCCGATCGACCTCCCCAACACAGATCGTCCCCCA
TTCTGGGGCGCCGACTAGGGCTTCTCTTCAGCAAGATGTCGATCGTCTGGAAGCCGACTTGCGCCAGGCTCGCGGAGCCCTCAGTCCGATTCGATCCGCT
CGTGATGCCGCCCAGGCCCGCGTTGTGTCTCTCGAAGCCGAGACTCAGCGTACCCGAAGCCTGCTGGATCAGTCGCAAGACGACCTTGACGCGGCCCTCA
CCGAAGACGCCCGTCTGCGTAAGTACTCGAACACGCTCTGGTTGATCGGCCCCACGATATGCGTTATTCCACAGGATCCGACCTTGCGGCCGTTCGCCGT
AGTGCTGAACGGGCTCAGCAGGCGCGCGACTCCGAAATCGCCGATCTCCGTATGTACCTTGCTCCGATCTGGGTTCGATCCAACCTGATACTACTCATAT
TCTCCGTGTCTTCCAGGATTCCAGCTCGACGACGCTCTCCGAGACCTCCGCTTGGCAGATGCGCACTTCGCGGACGTTCAGCAAGCATACGGCGTCCTCC
GCCGCGCTCAGGAACACTCGGAGGAAGCGCTGGACAACGTGTCGGAGATGTTGACTCGGGTGCTCGGCTGGGTGGATCGCCGCCGGACCGAGTTCCGTCG
AGGGAAATCTCCTCGGCGGATCGCTCTCTCCCGACGGCGGCTCGCCGCCTCGATCGCCTCCGAGATCTCCTCCTGGATCTCCTCCTCGGTCCCCGGGGGG
ATCGCCGCTGACACCTTCGCTGTTCGCGATCGGCATAGCTATCCTCGGGTTCAACGCCCTCCGAGTGATCAACCCTGCCAACGCGTAACCATGGCCTTCA
ACCGTCGTGAGCTCCCTCCAGCTTGCCGGATTGATCCCGACTTCGTTCACCCGGGCGCTGGCATTGCCTCTCGACTGGCTGTTTCCGCGACGGGTTCGGG
GAGTAACCCCACCATCCCCTGGAGTTGGTTATCGTGACGATCTGATTTCAGGCGCTAACATCACGGTTCTGCTAGCCGATCGTCTGTGGCGGCGTATGGC
CAACCCAGAAGCGCCGCTGACCTTCAACTTGAATCTCCACCAGCGCGCCAACACGGGATTGGGACGGAGCGCGTCGGCTTACCAGACCTTCGAGCGGCAG
AATTTCCAGGCCTTCTGGGAGCCTACCCACTACTTCCTGATCACTGGGCGCCAGCGAGAACGGGATGCCGTGATCGATCGGTATCACCACGATCGACGTC
AATGACGGATCAACGTGGGCGAGAGATGGCGTCGTCTGCTGGCTGACATCCTGCCCATGGTGCGGAAGCAGTGGGCCGACATCGATCTGCTGCTCGATCC
GTTCTTCCTCCATCTCCCAACTCCCCACGACTCAGTGACTTGGTATCCTGGTGCAGCGTCGCGTGCGGGAATCGcaggctgtagtgggtctaacttgact
cactactttagcttacacgttgcgcaacgtgtgtgaggaagcgtaagtacttagtaattacttaggttaattacatttgaatacacaaatataagttaac
ttagacaagactccaagtagccagtttaaggtaaaatgagaactgtattgtgtgtaaattgatcttggcagtggctggctgtcagagccccgctaatatg
catgtctctgattggtagaaagatgctgctttctaccaataggatctattgggtatgtgtggaccactcactgtggtggtccacttcaatgtatccattg
gtgtgccttacaccaatgtgaggaagtatccaaaacttttaacagataacctatctgttaNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN