Description :
From Genome Similarity Track
Location :
Scaffold_88:57858- 62858
Sequence
5000 bases(100 bases per row)
CGCGCTAAGTGGATACCTAGGTATCGCGCTCGTGTGACTTATGCCCCTGGCAAGTTTGCACGGTAGTCGTCTCGCCGCTTGGGTTTGCTCACGGTAGGTG
AACTGGACTTGAACTTCTTGTTCCGTCACTTCTCTCGACTCAAGCACTACTTGTTTCCCGTTCCGAACATCGCGCTCGCCCGCCGATCGGGTCCCAATGG
TACCCACTACTGGTGACCTCGGCACAAATCTCCTCGTTCTACAGTCAATACCATGGGACATACTGGATCGGCTAATCTCTTCCGTGTCCTTCCTCCCGAC
TGGCTAGTTTTAAGCTTTGGTGAATGCCTACCGTGGTATTGAAGATCATCATCGCCAGTCACTATGGGAGTCCACCCATGTGCTACCAATCATCTTCGGT
TCAAGTCGCGCGAAGGATCCTGGGTTGAGCGTCTACTTTAAAGAAAGGCACCGTCAAGGTTCCCGATCTATTCCCCGGTAGAAGTCTGTGCTCCGGATCG
TGCTGCAGGGGTTGGTCGAGGGTCGGTGCGCCTTCGACATCCTGCTAGACCCTTCTTCCTGCACTTTCCCGGACGCTTGGAGAAATGCCTGTGGTATCCG
GGTTTCGGCTGTCGGTAAACCAACATCCCCAATTTGCGCCTGACAGACTCCGCAGATCTCCGGCGTAATTAATACTGGACGACCATCGCTGATCACCCGG
GATCGTCCATCGACCGCCTCAACAACAAGTTTGTGGATGAGTGATTCGTCGTTTCTGCTATAAAGGACCACTGTGTTTGTGGCCGCAGTCGTGACTGCAT
GTCGTAATCATCAATTCGCCTGCATTCGCTTATTTTATTCCAAAAAAAATCGTTACGTTCTCCCCATTACCAGCTGGCGTAGTCATTGTCCTTTTCTGCT
TATGAACGAGACTATCACCATTCTTCGTGGTCGAGGTAAGCACCTCTGGTCACCCTAACCTCTGGGTTCTTCTTCGTGTACTTGCACAACTTCAAACCGA
TGAAGTTTAGCTTGATCACGTTCAAATTCCTGCAGCAATGTACCACAATTGAGGTTCGCTTCATCCACCCAAGTTTCATCATCATGACCCTTCCACCGGA
CTAGAAACTGTCGGTGTGTTCTTCCAAATCGAGTTTTCCGTCCAGGTCGCACACCTCGAGTACTGTCCGCTTCGTATTCTCCTTCGGCTAAATTGCCTTC
CCAACTGTCCTCCGGCAGAAGAGCTTCATCAAAATCCACTACGTCTCAATTTTAGCTTAGAGATGAGCACGAGCAGGAATAATCGATATGGGGTTCCTTG
CACTTCCAGCCGCACTGCATGTTCTCCACACTTTTCGATCACCCGGAATGGGCCATGCCACATGTAAGCCGACTTCCTGGCATATCCTTCTTTTACTCGA
TCCAAATACATTCACACTTGGCTACCACAGCTTATTCCATGTAGCCGTTGATTATTGTTGTGTTTATCAGCCCGTTCCTGACTAGATTCCTTCAACCGGT
CATTCACGGTGGCCCGGGCACATTGGTACTGTCGCTGTATATGATAGCGCCATCTCCTGGGGTCACGATCACTTGTTTTAGTGCACCCCAACGGAAGGGT
TGCCTCCAACGTCGATCGCGGGTCCCATCCGTGGATAAGGTAGAACGGAGTGTCACCCCAGACTCGATCATGCGCTGTATTGATGGCGAAGGTCAATCGC
TCGGCGTAGTCATCCCAGTCTTGTTGGTTCACTTCCGTGGCATACATCTTGAGTGCCCTGGTTAATGTATGGACCACCCGTTCGGCGGTGCCATTTGCCT
GAGGACGATACGCCATGTAGCACGTTTCTTTTCACCGGCAATACGTTCGAATGCGCGAAAACAATCCGACATGAACTCAGGTTCGCGATCATGACGAATA
GATTTGCTCTCCCCCCAAATCGCCGGAAGACGCATTTTTATACCCTTCCACAATTGTTTGGGCCGTCCTCGACGAGCTCGCCTTAGCGATCACGTTGCCG
GAAAACAAATCAACCCAAAAAAGCAATTCAGTTTTTCTATGAATGACTGTGGTAAAAAAGGGGTATGATTCATTGCAATATTCTGAAAAGAATAATTTGG
TTGCATGTTGCCCGGATATTCTCCACGTATCACCGGACATCCCTTTCCGGTTTCGCTGTTGGCACACTTCCCCACATACTGTTGCACGCTTCGGAACAAA
CATATCCAATGGAAATGTGATCTCACACGGTGATACGTGCGGTCTCCCCCTTGATGATCTCGTTCCCGACTTGCGTGATAATGGCGTAAAAATTTCATCT
TGAAGTAGCTCCAGGATCACCAGACGAACGAGCTCAGCACGATCATCGGGGTTTGTCGTGGATCGTGGGCAAAAATACAACAATCCGCCTTCATCTACCA
TGTAGTATGGGGCAATCACGGCACTTGCTTTTGCTTCTGTAGCACCCAGTTCCGTTACATGCACGACTAAGTAATAGTTGAGGTTAGCAATCCTACTTTC
TTCGTCTTTCGCCTGTTTTATACGGTCGAGTCGCACCTGCTATACTACGTCTTCTCGTATAATGGTAAACGCCTCACGCCTTCTCATGGTCGATCTTGTA
ATCGCCGTCATCTTGATCACTTGATCATTGCCCGCTGGCATCAAAATTTGTCCAGTCGGTTGATGGCGCTCAGATCGTGGCGGTCTTAATCCGTTAGCAT
AACCATGCCCTTTTCCAGCTGTAAAGAGGTGCTAGCCAGTTGATCTGTACTTTGAGTCCAATCGCGCGTGACGTGTAAGAATTCATGTGTCGGTCACGAC
CTAAGTTTATCTAGGGCTTTGAGACGCAGTAATTATATCCCTGGCGCCTTGCAATCAATCTTACCCCATATCTGGCTGATGACCAGCTTGGAATCCTCAC
AGATGACCACTCGGCCCTTTTTGTATGTTTCGCCAGCAGCTTGCAACCCGGCAGTAACCCGTGATATTTTGCCTCGTTCACTGGTAATCCAGTATCAAAA
CGCGACGCGGCCGACAATATTGTCCACTCGGGCAATTTCCATATCACTGCAATGTAGGCGCCTCTTTTTTTCTTAATACGTGCTGACCCATCAAAGCTGA
CGACCAGAAGCACTACACCATGTCTGACCGTAGGGGGCGGCATACTGATAGTCTGTCTCGGTTGCTTCCGTGGTGCATTTGCGATAAACATCTCATCCAC
CTCGTTCCACGGTGTAATACTCGCTGCGAGGGTGCCAAACATTTCGTCCTCCCTTTGTTACACCAAATAGTCTCCAGCGTCCAAGTCGACAGTAAAGCTA
CCCATCTGCCAAGTCGTCCATTATACATGATGATTGCATCAACCATGCCAAGGTAGAGTATCTCGTGAGAACCTTAACAACCCTAGAGACCAATAGCGTA
GAGAAAAAAATATCCAACATCCGGAGCAGGGCTAGAACTTCGATCTCTACCGCTCCGTAATAGACTCCATTTGGTTTTAACGTTCGACTTGTGAACATGA
CAGGCCAATTCACTCCATCAAGTCCTTGTAGCAAAGCTGCGGATAACGACAATTTGCTAGCATAAACCACGACCATTAGTTGGAGGTCTGGACCAAAAAT
GTCTGAGCACCGGGATTTGAGCTACTTTAGCCTTCAACATGGTGAACGGAATACATGGAGTTCTACCAACGATGAGTACCAGTATGCTCTCCATCAGATT
TTTTCAATTTAATTGGATCCTGACCATTCATTGCCACCAGCTGATGATCGTGCTCACCTGCAGTTCGCTGCCCGCGGTTATTATAAATATGGGTACTATG
GACGTGATCATAGCTGGGTGAGCATTCATTATCCGTGTTGTGCGAACGCCTGATCTCATGAAAATCAGCTTCCCTCAATTCGTACAAGACCGAGGCGTAT
ATGGCGAAGTCTTCAATGAACCGGCTGTAATAATTCAGGCTTCCTAGGAAGTACGGCATTGACCGCAGTGTCTGGGAAATAGGAATATTCACGAACGACG
CCAGATCCTTCGAGCCATCTTCGATTCCTTTTATTGACACTTAATGCCCGAGGTACTAAACCTTGTTACGTCCCCAGACGCTCTTAGGTAGGCTGATCGA
CAAATTCCACAGATCACACACTTCCAACAGTCTTTCCACATTCTGATAGAGATACGTCCAGGATGACGCTGGGATTAGACTGTCATCAATGCAGTACCTT
CGTCCTAGAACTGAAGGGTTTCGGTGCAGGTTTGGTTCGCCGTCCGTTAACACATCGACCTGTTCAGCCGCCTCGTGGTCACTTTTTTCAGCCGATCTCC
GATGATAAGATATCCATATAGCGCGTTATCCACCATACGTTGATATATCTTTGGCACGTTTCTCATACTGAACGGAATGCGTAACCATTCATACAGACGC
GAGGGCATGATAAAAGCAGAGACCATTCGTGCTCTCTTCGTCATCTCCATAACCCAGAATCCGCTGGCCATATCCAATGAACAGTACCATAGCACTGTGT
CCAGATCCTGCAACAAGTCGTTGATCAGAGGCATGGGATACACCATCAGCCTCATCAGTTGGTTAACTCTTCGGTAGTCAATACACAGCCTTGTATCCAC
ACCATTCTTATTCAAGGTCACTACGATCGGCGACGCCCACGGAGAAGTTACGGGAAATATGATTCTTGCCGATAGTAATCCTTTGATCAGGTCCGCCAAC
TTTTCACGGAGCTTTGGGGCGACTGGCCTTACTCGTTGTGCAATTGGGGCCGCTCCTTCAACATCTTTATCGCAGTTACACCTCGAGCAGCGGGTGGGAG
GGCGTTTCCTTTGCCCATAAGAAGGTGTCGTTTCGTCCAGATCAGCTGATTTAATTTCTCTTGCTCTCTGGTCAATGGGACCCCTGGATCTCCCCCCTGT
CTGTAGTCATTTTTTTTACCTCTCTCAGCATCGCGTCTACTTCTGGTAGGACTGCGATATGTAGGCCAACATCCTCCGCAAAGAACACTCCACTTTCGTG