Description :
From Genome Similarity Track
Location :
Scaffold_42:5785- 20441
Transcript NameFunction/comments
Phyag_g1041hypothetical protein
Phyag_g1042conserved hypothetical protein
Phyag_g1043conserved hypothetical protein

Sequence
14656 bases(100 bases per row)
CGGTCGCCGCTTGGGGCTGTCGACCAGCGCTACGCCCATGCGATGTCATTTGGTAATCGCGCCAAAGTGCAACGAGTGGGAGCGAATGAATGCCACCTTT
GCGAGTCCACCGTGGCAGTCCACTACCTCAGCGGAtgttgaaggtgtcgacgctAAAGCGAGGGTTATCAACGCAAATAAGCGCAGGCCTTGGGCCGCGT
CGCCGAGTGCTTGCAAATCTATCGGGACGCGAGGAGAAGCAAGGGCGACCAGCTGACAGGGCACTCACCGTCGGCTGGCATGGCCGAGCGCATTGTTCAG
CGCTTGTCCCATAGTTGCAAGAGTCAGAGGCGACGCGGTGATGGGCCATCACCGATGGCTCCGACCGCGGTTGAATCAAGAGATGTGGCGGCCTGCTGTG
CCAAGCGGGCCTCACTCTCGACTTGGCAAGGCAGCGAGCAATAGCTTCGCTCGGATACGCCGCCACATTAGCTAGCATTCGGCCTGCCGCCACGATGCCT
CGACAAAACTctgcggcgtcggcgtcggcgtcagCGTCGGCATCGAATTCCTCCGGCCGGTACGCGCGACTCTAGATTTCGTGTCGTGTCCGGCGTAGCG
TCGTCGGTAGCAACGGTCTCACTAACATTGGTTTCTGTTGTCTTTGCAGCGATCCTGGGGACAATCTGCACGACAACGGCGGCCACTTCCCGCTGCCGGA
CGACTATTTCCCGGAGATCCGCCTCACACCCACGGAGGTCGCCAACTATGAGgcgcagatgcaggagaTTGTCAAGAACGCGTTGGCTGAAtacgagctg
cacgagtccAAAGGGGCGTACCCCGTCTATCGGGCGCCGTGGAACCTCGTGGGCAAGGTGGAAGGTCTCACgacgatcaagaaggagaccCCCAACGGCC
CATCGCCCAGCCAGGCCCGCATCTTCGGCCGCATCAACGGCGACTACCGTCACTTCATTGACTTCTTCTACGCCGAACGATCGGCCGAACTCTTCGCGTG
GAACCAGTTCATGTTCGGTTACGCTACTGATGCGgccgtgctcaagaacaTCCACACGGTcttgagcaagaagaacaagtgTCTGTACATGGGCATCAAG
TGGACGTGTCTGAACCCGTCGCCgctcgtgaagaagcgcgacAACTGCTACATGGAGTACCTCATCTATACGAAAGATCTGCGTGGACGTGACGTGGGCG
TTCGTGTCACGCTACCGCTCGATATCCCTGAATGTCCCGAGCTAccgaagaagctcaagacgaAGCGGATGCGTCTCAACACGGTGTGGATCTCGCGACC
TGCTGACCAAGAGCCTAATGTCACCGAGTTCTTCATGCTGTCgcacaacaacttcaacggaCTGGCGGTCACCGCCAACTACTACAAACGAATGATGAAT
ATTCTCATGAACATGtccgtcttcgtcgactCGCGGCGCATCTTGATGCAAGGCGTATTGACCCGGAAGAATTGGGCCAAGGCGGGGTCgaggaaaagct
gcagcgtgtgctcGCGCAAGTTTAACCCTACTcgacgccgccaccactgcagATTGTGCGGAGACCTCATTTGCCGGCGGTGCGCTATCGTTCGAGATGC
CCCCAAGGAGGTCGATCCAGACAGCGCAGCGAGCTCAAACAGGACGTtcgagatcgccaagacgAAATTTTGCGTCCTTTGCGTGACAAAGATGCGAGAA
TCCCGCAACAACATGCTGGTGCCGGTACCCGCGCCGAGCGGCAAGCTGTCCGTTGTGGATTGTGTGGACGTGGACCTCGGTGGCTCTCGCAACTCAACCA
TCTCCGAGACCGAGTCCGAAGGTGGCCACATTTCATTCTTTTCAGAGACGGGAAGCAGTGAAGGTGCCCAGTCCTTTCAGCTCTCGCCGCGGTCAACAAC
TTCAGGACTCGGCAAGTTGTCTTTCGTGTCGAAGCTTGATGTTATTGACGACCAGTCTGTGACGATTCTAGCAGACCCAAGGATGACCGACCACGGGTTC
ATTGAAGAGGAAGTGACGGAAATCGATACGATTGATATGGTGCCGCTGTCACGGCGGGGCATTAAGCCGAACCAAGTTGCCGACTATGACTCGGGCAAGA
CGAGTCCAGGCAATTGGGACCCGCTTGGTTCCAAGACTTCGCCGCGGTCGCTGGACCAGTGTCTTGCTGAACAGGAGGAGCTACTCCGACGCATGATGCT
CTCGGCCAGCGGAATCCGCCAGCAGAACAGCGCGAACCCAGGAAGCGGGACCTTGGGCAACATCGGGGGTGGCGGTGCCTCCGGTGGCGTTCAATCGACT
CGGTCTCGACCCGATGTTACACTCTATGAGGGCTAGCCCTGTCTGCAAGAAGCACTATAAACGAGGGCAGCGTAATTGAAGAAATGTGTTTTGTCATGTC
AAACTTGTTGGTCCCACTCGACACATCGACTTTGGTGCTCAAGATTGAGTTCAAGATTGGATGCGATCTCCGCAGCCAGAAGCACCACGATTACATCCGA
CGTggtgctcctcctccgaagGACTCCTTCAAGGAGAGATGCCTAACTTGAATGTCTTCGTTGGCAAAGCTCACAACGTCCATCCTTCCAGCCAAGCCAG
TCTTTGCTACGGACAGGCTCGGCTCGCAGCGCACTGAACGAACGCGTGTTCTTCTCAGCTCATTGCATCCTCCGCGTTTTGCAGGTGGCTTCGCCAACGT
TAATGGCGACAAAGAACCCTGCAGCCCTGCAGGAAGATCGCCGGCGACTGCAACCATGAAACGATGCGATCCACACAAACAAACGAACCGGCTTCCGTGA
ATGGGGGTAGCCAGCGAGGCTCGCACAGTCATTTATCTGAGACGCGCGAGCGGATCCGGAGCTCATAATCCTTCGATCGAACGAACAATGCCACCGCTGC
CTCCGCCAAATAGCATACTCGGCCTCCTTCGCCGCCTACTCATTTATGTCTCCTCACTTGCCTGCCATACAAAACGCtgtgcgcgagctgctttgTCACG
CCTCCGCAACGGCATATTCAAGTCGTCCTCGCGAAAAAATCAACCTCTTCGTCGCACGACCGCCGGCGTGAGTGCCTCAGCATCGCAGGCAATCGGATGG
AGTCCGTTCACTGGCAGCCGAGCCATCAACACTTTCAGACTTGCCAAGCAAGCCGTGTTGAGTCGTGTCGTGCGGTCGGTCGGTCCGCCTTACCAAGTGG
CTTAAGCGCTCCTAACGACCACACGACCAGGTGTGCTCAGAGCTGCATTCCCACCTCGTTACTCTTCAATCGCCGCCATGCCCCGCAGGTCGTCGCCCTC
CCTGCCGCGCTCGGCTTCCGTCACCTCCAATGCATCCTCGTAAGTCGCTCGCCATCCAGCCATCTGCTTGTCCGGCAGTCAGCTTTCTGAAGTTTGTAAC
TGTCGCTGCAACTGTTGCCCTTGCGGAGACATTCGGTGCTCACAACTACAGCAACTCCTCGATGCTAACGATattttgtccttcttgtgcaGATACCGAC
CTGGCAAGCTCCAGTTCCCACTGCCAGATGACTATTTCCCGGCGGTGAGTCTCTCGTTGACCCAAGTGCAGGAGTACGAGGCCAAGGCGAAGGATACAGC
CGAGAAGGCACTGGAAGCCTACACCGACCACGAAGCACGCGTTGCCGGCTTCGGACTAGATGAACGACGCTGGCAAGACGTCGCTAGAGACACAGACTTG
GCGATCGAGCGCCGCAAACAGGGACCGCTTACCATCACGCGCACGTTTGGAACCGTCACCGTCGACTTCCGTCGGTTTGTGgacttcttctcgtccgaga
CGTCCGAGCAGCTTTTTGCATGGAAccagttcttcttcggctgtgCGGTGGACGCTGTCGTGCTGTGCAATCTGGACTTGGACAAGTCCAACACGCAGGA
GACGCTAGGCATTAAATGGACCTGTATGCAGCCGTCAGTGCTCACGCGCAAGCGCGACGAGTGCTTTCTTGAGTATGTAGTTTTCAAGAAAGACAGCCAG
GGCCGCGACGTCGCCGTGATCGTGCGTATACCCGTGGACATCCCTGAGTGTCCGCCACTTCCGCACGAGTTGAAGACTAAGCGCGAAAAGATCACCACTA
TCACTGTTGTGCGTGCTTCGGATGACCACCCGAACGCGACACAAATCTTCATGTTGACTGAGAGCGACAACAAGGGACTCACCGCTTCCTCCAAGtactg
caagaagctgctgcgggcGCTGAAGAATGTGTCGTACTCGGCCGACGCCAAGCGCATCGCCACAGCTATCAGCACGCCAGGGTTTGCCGAGCAGTCTCGC
GTTGGTGGCGAGCCTGCTGCCTTAGGAGATACCATCCGGCCTTGGGTCCCCAACACGGGGATTCAGCAGGGCTGTACTAGCTGCTCTCGTCCGTTCCGTG
GTGGCCACAGACGTCGTCATTGCCAACTATGCGGCGACGTGTTTTGCTCTAAGTGCCTTGTTCGACGCGCTGGCATTAGACAGGAGAAGAACGCCTTCAG
CAACTACATCACGATGACCAACCAGCGGACATTCCGCGTGGCGCAGTCGCTATTCTGCAAGGTGTGTGTCACTCGCTCTCGCGAGGAAGACGCGGAAGCT
CTGCAGGAGCAAATGGAGGCCACTCGCCGCTCCATAgtgtcgtccaagtcgtcgtctGTGCCGCGTCGGTCGTCAATGGGATCATCAACACAACTGCAga
gctcgacgccgacgtctTCATTGCCGCGCAGTTCGACGTCCCAGCAAACCGACGCACCTCGCCGCAGCGGAACGTTTTGCGAAGAGAACCGAGCGTCCTG
GTGGTCTGAATCCGAGTCCGACACGTGCAGTTGGAAGTCCGGGTCTAGCCGCTTCAGCACCGTCTCGCGCAACTACAGCGGCGCCCCCACTGTGCGTTCG
TCGCTCAGCTCCGAGTATTCGCTCGGCAGAAACTCCTTCTTGGCAGTGCAATCTCTGGAAACTCCGCGTGAGATCGACGCCGACCGGGTGGACGACCGGA
TCGACGAACGAACCAGTATCTATGAAGTCATCGACACCAAGGACATGCTGTCGGAGTCCGAGCTCCAGAAGCAACTGCGAAGTCAGCAAGCCTCCGTTTC
CGAGTCGCCGGACTCTGCAGACAACGATTTCTTCAGCGAGTTCCCCGACACAGCCCGTGCTCGCTACACGTCGACACCTGTGGCTCCTACGTTTTTGCCG
CCACGCGCAACCTCAAGACGCACGCGCAGCACCGACCAGAACGAAAACGCCCCGGCGTCGAAGTCGCTGGACCAGTGCATCGCTGAGCAGAACGAGTTGC
TCCAGCAGGTTCTCTCCGCCAGCCGTGGCTTCAACCCCGACGGTCAGGCCCGGAGCATtcacgaagacgacgacggccacgacgacggcgtttATGAGCT
GTAAGTCCGCTCCGTCTAGTGTAGACGGGGGTATCCACCGCGAAGCTAGCGGTGATAGTAGTAAACCAACCACTCAGCATGCTATGAGCAGAGTACACAC
AGAATCTAACAGGCATCAATGCAGAATTCATTGCACCTACCATCCGCTCAACGAAAGTCCACTTGGAGATGACAGCGGGCGGATAAATGACCATTCCAAC
GGAGACTTTGATGTACGCGCAGTCGGTGTCCATCCCCGtgtggtggacgacgcgaaAGTATCACGGAAGTGATGGAGATcgcaaggagaagaccgTGCGC
CAAGTTGACGGTCAACGGCCGATGAGTGCCGAGATTTTGCGTGGCGAAGCGAGCATGTACCGGTAGATGAGGCATGCAGACGTCGAGCACGCTTGCATTG
CGCCTTGGCAGCGAAGTTGAGCCGCTCTTGTAAGATAAGGCCGACAGCCACTGGTATAATGCCATCCAAGCGCTTGGCCGGCCATCTGGTCGCTCGCATC
ACCACGGGGGTCGCTAAGGAGGGCCCTCGCGAGAGACTGAACTTTGGAGTCCCAGCTGTTGTTGGGAACACAATGCCTAGTTTGAAGAGGCCTGGCAATA
ACTCTCGCGAGGCTGGGGAGCACAGCCACATTGCGGAACTGGCGCGATGGCTGCAACGTCCGTCACGAACACGAGTCAAACGtaagctcctgctgctcct
tgcACTTCTTGGCCGTCAATAACGGATCCGGTGTTTCATGTGCCAGGTCCGACATGCTTGCTGCGCGTGCCAGCGCGTTCCCGTTGCCCGACGACTACTT
CCCGGATGTCCAGCTATCGGCGCTCCAGgtcctcgaactcgagcagaagatggcgcTCGCCGTCAAAAACGCACTGGCCGACTATGATCTGCACGAAGCG
ATGGGGCCGGCCCCAAGCTACGGCAAAGGCTGGAAGACTCTGGGCAAGGTCGGAGACCTCACCACCGTCCGACAGAACGGCGATGCATCCATGTGCCAAT
GCCGCATCTTCGGTCGCATCGGCGGAAACTACCAGAACTTCCTCAACTTTTTCTACGCCGAGACTTCCAGCGAGCTTTTCGCCTGGAACCAATTCATGTA
TGGCAATGCCGTGGACGCCGCCATCTTGAAAAACATCCACACGAGCTCATCGGGGAAGCCACATCTGTACCTCGGCATCAAGTGGACGTGTCTGCAGCCG
TTCGCcctcgtgaagaagcgcgacACCTGCTTCCTCGAGTACATGGCATTCACGAAAGACTTGAGAGGGCGTGATGTCGGCGTGCGCGTGAATATGCCGC
TCGCACTGCCCGAGTGCCCACCGTTACccgacaagatgaagaccaAGCGCATGGAGATGCTGATCGTGTCCATTGTACGTGCCACCGAAGGCGATCCTCG
CTCCACCGAGCTATTTCTCATGAGCCAGAACAACTTTGCCGGCTTTGCTGTCCCCGGCTTCTACTTCAAGAGACTCATGGGCAAGATGAACGACATGGCT
ATCTGGGTCGACTCGAAGCTCATCTCGGTGCATGGCGTGATGAAGCGGACGTGCTgggtggacaagaaggcaCGGTCGGAGTGCCGCTTGTGTGCGCGCG
ATTTCACTACGactcgccgtcgccaacacTGTCGGCTTTGCGGTGAAGTGTTCTGTCGGCAGTGTTTGGTTTATCGTGGCGCCCGggacggcgatgaaga
cggcgacagcACGGAGAGGACGTTCACCGTAATCCAGACAAAGTTCTGTCGGGTGTGTGTGGCCAAAGTTCGAGACTTGGacgtggcgttgctggcgcCG
GGAGCTCACGGCAAGATCGAGGACAAACCCGCTGATGCTCGAAGCATGTTCGCGGACTCTAGGGCGTCGACAAAGCCCGACGGTGAGCACACTTCTTTTG
GGTCGTTAAACGAGGAGGACCTGAAGGTTTTGCGTCGCTCGTCATCCGATTCTGAACTACTCGAAACGATTCGTTCGTCCGGCGAACGTGATGATAATGT
TGTAGATGCCGGCAGCGATGTGGACgggagcagcaacagcaacccAGGACGCACCATCGGCGTAGACATGTCCAACCTGATGTCTGCGTCTCAAATGATG
CGCAAGATCAACGCTGGCGCCTCCTTCGACGAGGACAGCTCTTCCAACCAAGACATCGCCACTTTGGGCAAGGCGTCGAGACGCACCATTTCCCAGTGCA
TCGCGGAGCAAGAGGATCTTCTGAGGCAATTGCTGATCGCTGCTCAAAGTGAAAGAGCCCAGCATTGAGACCAAACCTCGTAGAGTCCAGCGGCGACATC
GGTTCAAGATCGCATCAGCGCATCAACGCCGGGattgtcgttgctgcggagcggacgcagcagcactggatAGCCGCCGCGCACGCATGCGATCGCCTAT
CGAGTTTGTCATCAACGCAGAAGTGGATCGTGATGAGCAGCACATGCTCGAAGTCGACGGCATTTACCCCAACTAAGTAATTATTCTTCGACGATTGGAA
TTCAGCGCTCATTAAGCATGAAAGTGTCGCTGAGCGAGAGCTGAGAGTCTCAGTGAGGCTGCTTCGTTCTGCTTGATAAGAACGTCGGATTGAACGTCGT
TTCTTAAGCACTCCAGTCATCCGCGCTCCATGGCCCTGGCGCTGACAAACCGATCAAGCGCGGGCGGAACTCACGATCGACACGCAGGATCGAGTTGAAG
ATTTGCACGTGGCTTCACGCCGACTTCAAGACAGCTCCACGATGGCTGGTGTCGCTACAAAATGGATGAACTGAACGGGTTAATGGGGTTGTGTTGATTT
GCAAACTCTCGACTTACGTGTCCACTGAAACATTGATCCAGGAAAATGACAATACACTCGAAAGTCCTAACACTACGTGTGATGTACGTGACCGCTCTAC
GAAGAGATCATCGTTGGTTCTTTTAGTTCGCGCAATTCTCGAACATTTACTGCTGCCCGCGGGCACCTGGCGGACGGTATCCGGCGGACGAATTAGCCGC
CATCACCAGACGCTTCAATAGCacttcctgctcctgcagacGCTGATCGAGCGACACGTTTGATCGACCCGTTCCGAATAAAACTTGTTCTGCTAGCGCC
ACATCCATCGGTGATTCATCCAGCGGGGACGACACGATCTGCCGTGTAGTGGAGACGATCTGGTTCGGCTCGTCAATAATCTCGAtcacatcgtcgtcac
taATTTCGAtcacgtcgtcctcgtcgtcatcgtcctcctccatcggAGGCAGCTTACCGCTTCTGTTGCTTGAGAACCCGTCGATTGAGCCGTTGTCTGC
GCTAGAAGGCGAGTCCACGAGTTGAACGGTCTTGAAGTCCAGAGCTGCGAGAGATTCCCGCATCGTGCGcatttcctcttcttccacctcttGGACGACG
CGCTCCGCCCCTGCCATTGTGCGGAGGTGACGCAGATCAATCATCATAGGAGCAACAGGCTCTGTGACTTCAacctcgatctcgtcgtcttgTGAAGACG
TCACGCTCGTTTTCGTTTCGGACTGCACCTCCGAGTCGATGCTGCTAGAAAAATTTTCTTGCGGAAGACTCTTGCCTGCAATAATGCACAGGTCGTCTTC
AGATATTTCGACGACGTTATCCTGAGGTGGAGCGGAGCGTGCAGAGCTTGTGTTAGCCGGTGACGGTGAGGCAACTGAGGCAACTGACGACACACCAGAC
ATTGCTGGATTAAAGTCGCTGTCAGACTTGTCCATGAACCAGCCTGTGGACTCGGCGTCCGAGACTCCTTCGTCTTGGCTGTCGGTCGCTGCAACGCTTC
TGACATCCGAGCCGCGGACCTTACCCATACACGCTTTGCAGAATACCGTCTTCACCACCTGAAACGTTCGCGGAGTCGAAGGAGAGCTGCTGTCATCCTG
CATTGGGGCGTCACGGACAGTCATGCATCGCCGACAAGCCACCTCGCCACAAAGGCGGCAGTGCTGGCGACGTCGCGTGGCTGAAAACTTACGGTTGCAC
ACAGAGCAGTTGGAGCGCGCCTTCTTCGGTGCCCAGCTACGGCGATCCAGCATGCCGTGCATCGAGATGCGTTTCGAGTCGGCGAACAACGCCATGGAGC
TCAAAGTCGTCATGAGTTTCTTGAATGTAGCGACCGAGGACGAGGTCGAGCCCTTGTACATGTCGACCTCGCTAGTCATGAAGATCTGAGTGGTGTCGGC
GTTGTCGTTCGTGGGGCGGACGATCGTCACCGTGTGCGAGTGAATACGCcgtgtcttcatcttttccGGCAGCGGCGGGCACTCGTCCAAAAGCAGAGGT
AACGTGATGCGAACGCCGACGTCACGACTTTGCAGGTCCTTCGTGTAGACGAGATACTCGAGGAAACACATATCGCGCTTGCGCGAGagcgtcgacggct
gcagacAAACCCACTTCATGCCCAGGTACTCATGCGGTTTGCCCGACTCTTTCGTGTGGATGTTGCACAGCACGGCGCCGTCCACCGCGTACCCGTACAT
GAACTGGTTCACCGCGAAGACCTGTTGCGCCGTCTCGGAGTagaagaagtcgatgaagttgCGGTAGTCGCCGTCGATGCGGCCGAAGACGCGCGAGGCC
TCGACTGCCCTGGAAGGGTCCACCTCGCGAATAGCAGTGAGGTGCTCGACGTTGCCTACGACCGACCATCTGGACCCGTAGTCCGGTCGGGCGCCCATCG
CCTCGTGCAGGTTGTACTCTGCCAAAGCGTTCTTCATGATGATCTCGACGCGCTGCTCGTACACCTCGATCTCGGCCGGGGTGAGCTTCAACGGCGGGAA
GTACCCGTCCGGCAGTGGGAACTTGACGTTGGCATTCATCTTCGGTGTCGCGCTGTCTCCCATCGCCGAGCCGCCAACTACGAAGCGGGAGGACTCGACA
CCAAACGCTCCTTTTGCAGTGTGTCAGGACGTGCATCACGGCCCACACTCGTGCGGAGTGCTGTGTTGTTGATGGCCCGTCCAACGTGTGCAATGCTGCA
ACGCTGCAatgctgtcgccgtcgctgtcgctgcgactTGCCTTCACACGCGCCTTTCGCGCCAAAGGCGGCTTTATGCATGCGCCGACATCCGGTTTcgt
gccgccgccgcagcgaGCACGAGATTTGCATGCCGAGCCACACAAGGGCGGAAGGAACGGCGTCGGGTCGGCTTAGTCGCGAGTCCCGCGCTCCCTCCGT
CTTGGCAGTGCGTGACAGGCTTCCGTCCAGAGACCTGGGTCTCCATCAACCACTGCCCGGCCTCCGTGGCTAGTGTGTCATCGTGGCTCTGGCTGCTACG
CCTGCAAGGACACGCGAGGAATTTTTGGCCGGGGGACAGTCACTCCGCCATTTCCGCGCGACGATGAGAGAGTGTGGAAGGccggccacgacgacgaagc
caaCCACCACATTGATCGTCTCAGACGATCGTCTGCCATCCTGCAGGGGAGCATCACGAACTGAAGGCCAGATGCCCACTTTTCGTCAATGTCCGCATGG
TGGTATTCTTTCGTGGTGCTCTTCAACACGGTGATGTTAAATGTGGCGTTTGAAATGGCTGTGTTGTCCGACATACGGAATGAAGTTGTGGGGCGTCGAG
CACCTTCGtagtggaggtggtggccatgtCAGTGTGCGTAATGAACGCGTCGGGGCGTCAGGGGCATCGGCGCGTGCGAAAGCACACGCCACACATTTTT
CAGCCGAGGCACGCAGGACTTGCAGACGCGGCCTGCCTGCAATGCTTGAACCCGACTCAGCGCAAGAGTGGcgcaaagctgcagcagaagtgCTCAACCC
GCCTCGCCTCGAGCTCTTGTCGAAGGCACTCATCAGCAGTTTCCGGCACCGCGCTGGCGGGAAGTGATCAATGTACGCACGTAGTCTATCTGGACCTCGC
TCGAGGGCAAACACGGCGCTCGGCGACGACATCAGAAGCTGACAACGTGTCTCCTTCAATGCCAAGATCCTGTGGCACAGGCTGTGCATTACGTCTTATG
GAAGCGGCGGGTTTGTCGCCGGCGGTCTCCGAATCGGAGACCGCCCCGAGGGAGCAACAGTCAATCTAAGATGATTCATCTTCCGCGATTGCCCGGCGGT
ACACTTCCCGTGCAATTCCTCGTCGACAGCTACATGGTacaagttgttgcagattTTTGCTGCGTCCGCACCACTTGAGCGATGCGCGTTGAAGCGCGGC
TTCATCCACGAGCTGCGTTGCTCTCTCCTCTCCATCGTTTTCTCCTCGTGTATTGCTTCTTACATTCTGATCTAACTTTTACGGGGACAAGGCCGGTGtg
tggcggcgctgcgcttCGTCCACAAACTTTCGGCACAAATACGGTCCACCCTGGACTGTATCACCGAATGCTTAGTAAGGTTTAGCCCGGAACATGAAAC
TTCAGGTGATGCATTCGTGTTAGCGCCACACGAGCGGGCCTCCCTATACGTGTATGTACAAATCGGCTCGTACTGGCCTCGAAAAGGCATAGCGCTACGT
tggccatcaccaccaaccaCGCCATGACGGACTCGCCAAATGCTGAGCCCTACACCAATGAAGTCTGGAAACTGAGCTCGGAACTGAGCTGGCGTGCTCG
GGACCTTCGGTCGCCACGAACCCATGCAAACAATGGCTCTGCGACAGCCTGGAGCGCTGTCCGATCCGCGGAAGACAAGGCTGGCAATGACTGGCGATGC
CAGCCTTGTGCTTGGAGTCGGCACGAGGACCTTGACCACACCCATCTTTTCCAGCGCGCTTCGTTCCGGCTACGCTCGAGTTTGTAAGTGACCATCACGA
CTCTTCTGAAGCGCACATCGCTGCAAATGTCCCCAGCTGGACCGACACGCATCCGTCTCTCGGTGTCGGGGCACTGCAGCTCTCGGAAGGGATCTCGAGT
CTTTCGCAATCGACCAGGATTAGTTTAGTTCTCGTTTTGCCGTCGAGATGCTGTCGAGGCGGAGCCGCACCTTATCTCGGTACGTCCAGTGCATTCGACT
AGAAATAGGCGCTGActcacgagcgccacgggATCCGTTAACACTAACGAACGAACGTATCCGCTATCCACGGTCTCACTTCAAACAGGAATGACGCCAA
GACGTTCCCATTGCCCAATGACTTCTTTCCGGAAGTCAAGCTCACGGACGAACAGATTCTGAGCTACGAGATGCAGGTCGAACAAATCGTCCAGAACGCT
TTGGTGGAGTACGAGCACCATGAGGCGACAGGAGGCTATCCGATCTACGGCAATCCTTGGGTGCCCGTCGGCAACGAAGGTCCGTTGACCGCCATTCGAA
AGGAGACACCGGAAGGGCTATCGCGCAGTGAGTTCCGTCTCTACGGGCGAATTCATGGCAACTACCGGAATTTCATGGACTTCTACTACGCCGAGACGTC
GCAGGAGCTCTTTGAGTGGAACCAGTTCATGTTCGGCTACGCGGTGGACGCGGTCGTGCTCAAGAACATCCATACAAAGAGCTCGGGTAAGGCGCACGAG
TACATGGGCATCAAGTGGACATGTCTGCAGCCGTCGTCGTTCGGCCGCAAACGCGACAACTGCTTCCTGGAATACTTGACCTACACTAAGGACGAGCTTG
GTCGCAATGTAGGCGTCCGCGTGACGCTACCagtggagatcgacgagtgCCCCGATCTGTACCGCTCGTTGAAAATCAAGCGTGTCAAGACGCACagtgt
ctccatcgtccgcCCCGCGGGGTCCTCTTCAGACGCGACGCAGCTATTCATCATGAGCGAAAACGATTTTGCAGGGCTGTCGGTGAGTGCCAAGAACTTC
CGCAAGTTCATGCGCATCTACAACGACATGTCCCTCTTTGTCGACTCGAAGCACATTCTGAAGCAGGGCATCATGTGCAAGACGAAATGGGTGCCCAACG
ACGAACGCAGGGCGTGCACGAGCTGCCAGCTCCCGTTCAATGCGGCCACTCGCCGACGGTACCATTGCCGGCTTTGCGGCGACATCTTCTGCCACCACTG
CGTGATCGTCCGCAATGTGCCGCGCGACTATGGCGTAGACAACAAGTCACGCATTTTCCAGGTTGCTAAGACACGCTTTTGCAAAGCGTGCGTGACTAca
gctcgacgaggaagCAGTGTGTCACAAACGAGTGCGTCGGGTCTGGCACGTGCATCGTCGGCCACGCATGTCAGCAGTGCTGGGAAACTCAGCTCTGATA
GCATTGACCGTCCCAAGCTACGTAAAGCGGTGAGTAATACTATGGACCAGAGTACTTCAAGGCCAGAGTGGTGGGATGAAGCTTCACAATGGTCCGAGTC
TGACTGGTCCGAGACGGACTCGGAGGACCCCATGAACGCCTCCGGTCGGTCGCGTCTCGCTagctcgctgtcgtcgtctcaGTCGTCCTGGACTTCTCGC
GTCGAGAACAACCTGGAAGACATGTCATTCGTGACCACACTGGAcgtcatcgacgacgacgtagCCCTGCTCGACGAGAAGCCTCAGCTCTCTAGGTCCA
GGCTGCGcaagaagttgtcgatgTCTGGACGGTTATCAACGAGTCGAAGGCACTCGACGCGCAAGCAGCACACTGAACCTTCGACAGACACGCAGGAGGT
GACCGAGGTCATCGACACGACGGACATGATGCCAATGTCCGAATATCGACGACAGTCAAAGGCAGGCCCCAGTGTTGTGCTACCCCCACGGAAGTACAGC
AAGCGACGCAGCGGTCGAGAGTCGTTGCTGAGCTCAAGTGGACCTCAGCCTAGCCGACGCATGAGTCGCGACGAGCCCAGCAATCGATTTCAATCGTCTC
GCTCTATTAGCCAGTGCCTCgccgagcaagaagagctttTGCGCTGCATGCTCAGCGTCAGTCGAGTGCACTCGAATCCTGGAAGGTCCAAGAGGAGAAA
CGCCAACGCTGAAAAGGTGAACTTTGCAGCTACGATGCCCGTGCCGCGCCCCACAGTTCGGCTCTATGAGGTTTAAcatcaacgcagcagctcatcgaaC
GAACACGCTTATCTATTATTTAGTGAACCACAAAATACATCGAGCGAGGTGACTGCGAACGAAGCGGTTGGCTCCTCGAATTGAAACCAGCAACCATTTT
CCTAGCAACTTTCGTCACCGAGTTGGTGCATGCACGTGGTCGTCAACTCGGCTGCATCCGGTTCCGTCGCCATTTTCGTTCGTCACTTGGCGACAACCAG
AGTCATGCGCGACGATCAAGTACCGCCGTGGATAGCCTTCGGTCAGTCATAGAGTG