Description :
From Genome Similarity Track
Location :
Scaffold_60:57846- 62008
Transcript NameFunction/comments
Phyci_93903Hypothetical protein
Phyci_229365Hypothetical protein
Phyci_193287conserved hypothetical protein
Phyci_93904serine/threonine protein kinase putative

Sequence
4162 bases(100 bases per row)
GATGCCTTTCAGAAAGCGGCCATGTTTCACGTTGTAACACTCTACATGCACACGTTGCAGCCATATGCGCGGACGTGCTTTGAATTCCTGAATTCTGCCG
CCTTCGAAACAACAAAGAGGGTCTTTGCAGCGGAGACCTTAAGAGTTATTAAATAACGTTACAGCATGCTTTCGGCAGCTTCAATTACTGACGTGGAGTA
CCGTAAGCTCACAGCCACGTGGGCTGTGCACTGCACTTCGTCTTGTAACAGGTAGGATACATGCACGGCTCAATCGTACTCAGCAGGTATAATAGATGTG
TGCACGTACTTGATGACTGAAGCATGGCTACTTCGTCCTATCCACTGTGTTCCCGGGTCGCAACTTATACGATCCGGTGTCCTGCGCCGTCCCAGTTCCT
CACCGCAAAAGTGTCGGTTGTTTGATGGTAAGCCTGCGCGCTCGGCGGCGTGCCGTCTGCCGGTGGGGATTGCGGCTGGCGATGTAGAGAGACACGGCGC
TGCTCTCGAGAGGCGACACCACTTTCAATGGCGAGCAGGTCTTCCGAGTCAACGCTGTCGCTGGTGATGCTCGCCTCCTTCCTGCTCTGGAGCCATTTCG
ACAGTGCCATCACAGCCACATAGCCAACGCGCGCGAACAGACAGAGCAACACGAGCGCGTTCAGGCAGATGATGATCTGGGCGATTAAATCGCGCACCCG
CTGCGGGACCAAGTTGGACGAGGCCAGCACGAGCGAGAGCAAAAGCATTACGATGCGCAAGTACGCAGTTACCAGCCCGATTACGTAAAACACGTGAAGC
AAGTACGGGCGCCGAACGACCGTGGCGACGATGAACACGGCGTTGAAAGCCACGAGAAGACTGAGCTGCACCATGGGGTCGTTTCCTGCGCCGACTACCG
CTCCGGAGGCAACATCCAGTGCCATCTTCGCCACGAAAAAGTAGCGGTTCTCCGTGGTGAAGTCTTGATAAAAGGAGCCGTAGCGGTGGTTGAATGGCTT
CTTCTCGTGCTCAACCGTTCCGTGGTCTGCCAGCTCGGCGACGTAGCGCGTGAGGACGAACACGCCAAACGCTGCCAGTCCAAAGCAGGAGGTGGCGAGG
ATGACGAGTGCCAAAATCAAACCTCCAGTGGACCGCTTGTTCAGAACTGAGTACGAAATCTGAAAGCAAGACGTCATGGCCAACGAGTACTGGAGCAGCA
GCAGCAACTGAATGATCACCCAAACGCTGCGGTCATCGAGCATTTGTGACAATGGGGTTCTCTCTTTCTTGAACACACGAAGTGCCAACCGAGCCGCAAA
ATAGAGAGCTACCAGCAGCCCGCTCACCACCAACAAGACCAGCAGTGTGTAGTAAAAGAGATAGTCTGGATTGACTCCTAGCGTGCTGGCATAACGACTC
ACACAGCACAAACTCGAGTCAGTTCCACCGCTGGACAGTAGGCGTTGCCCCGTCGTCCCGGAGCTTTTGGACTCCACAAGAGTGCTGGAAGGGAAAATCT
GTAGGTTTGTCCAACCGAACTTTGCGCAGAACTCGACGAAGAACACAGGTACCCCCTCCAAGTTGAGCGATCCGAGAAGTGTGATGAACTGGCCCTGGGA
GATCATGTGCAAGAGTTCAAAAAGACCCCCATTTGCCGACGGGATGGCACTGGCAGACGCCAGTACACCTACCATTGTTGAACCAAGCGCCGCAATCCCC
GCTATCCCCACACCTGAAGACGTAATTGCGGCCAAGAGCTTCCCAGCGTCGTTCATGACAGAGATCTGAAAGGACGAGTAGTTCGTGTTCAGCCCCGACA
TGGGATATTCCAGGTTCACGCCTAAACAATCGCCACAGGAGATCCCAGAAGTGTCGACGTCCCCGGCAGCACTAGCAACGCGAGAAGCCACCGTTTGCGC
GGCGGCCACAGCTTCATCATAATGATCCTTAGCCCACGGTTTGAGGTAGTAGTCGTAGGAGAGATACGCCGCGGGGATAATAACGAGCAAGCAGACTATT
GGCGTCAGAATGGCACACGCACAGCACCTCACGCAGCAACCGCAAAGGCCCATTGCTCCTTCGAGCAGTTTGTGAAATTAAGCAGCATGCCGCGTACGCA
ACAGTTCGAAACGGACGACGTTCGTACAAATAGTCTGACATCTCGATATTCAGTAGTCGAGTGCTAATACTTTCTAGTTTACCATTAGTGTGATAAGAAA
ACTACGAGGAGAGCCGCCAGGGCGGTGCTTTCTCCGTCTACAGAATGCGCTGCGGAGATCTATCCTAGGCTGGGGCGACATACAGGATGCCCATATTCTT
GAAATCGCGCTTTTTCAACGACTTCTTCACCAACGGCAGAGCCTCTAGGATGGCCCCGAAGTCGGGTCGGCGCGCTGGGTCGTGATGCCAGCAGTGCTCA
ATGAGTTCGCCGATCTTGAGTGGAGTCTGGCGTGGTAACGCCGGACGCATTTGCTGACGGGCGACAGCGAAGGCGGCTGTTCAAACATAGTCGCAAACGT
TAAGATTCAGTGCCCCAACAGTAAAATACGAAGCGTTTGGGCTCACCTTGAATCGGGGTCAGTCCGCGGAACGGCTGATCTCTTGCTAGCAGCTCCCACA
ACACGACGCCGAAGCTGTAGACATCTGCCTTGTTCGAATACGGCTCGTGGCGGATCACTTCTGGGGCCATCCACCTGTACGTTCCTGTTTCTGCAGTCAA
GTCAGACGAACATCCGATCTCTAGCACACAACTCAGTCCAAAGTCGGAGATCTTGGCTGTGCCGTGCGAGTCGATAAGCACGTTGCCGGACTTCAGGTCA
CGGTGCATAATGGAACACAGGTGAAGATAGTTCATCCCCATCGCCATTTCAGCAGCCAGACGGAAGAAGTCGATCGGACCGCGACGAGCGCGGATGAGAT
CGGTCAAGGTGCCATTCTCCATAAATTCAAACACTACACACAACAGAAGAAGGTTAGAATGGCCCTACCGAAAGCACACTACAGCAATCCAGAAAACTTA
CCCAAGCAGTAGCGAGGCGGGTTAATGGCTGCCCCAAGGAACAAGACGATGTTGGGGTGGCGCAGCTTGCTGACGACTGCCACCTCGCGGTGAAACTCGT
TGAGCAGCTCCTCTCCAACTGCCTGCGTGTTGGTGGACGAGTCGACAACCTTGGCGGCGACGTGCGTTCCTCGCCACCACGCGCTGTACGTGTGTCCTGA
GCGGCCTTGGCCGACAGCCTTCTCGAGACGCACCTCGTTCAAGTCCAGCTTCCACTCCGCCTTGATCTCGTTCTTGTCCACCATCTGCAGCACGCCCAGC
TTCTCGGCCAGACTCACATTTTCGTTGCCACCCGAGTCCTGCGAGCTGCTGGCGCTCGGACGCGTATCCTCATCCATGCTGAGTCTACGCAAGTTCTGCT
CGATGAGCGAGCGCAGCTCCTCCTGCCGCTCGTCGCTCATAAACGACCCCTTGACGACGAACCGGTCCAGCAGCGTGCCGTCCGCCGTGGTCATCACGTC
GGCGTCCAGAATGTTGCCCTTCATCATGGTCAGCGCGCGCGTGATGGCGTCCAGGATGTTCTCGCGGTCCAGCGACACGACCACCACCTCGCACACATTG
GGCACGATGTCCCCGTTGTCGTCCTTCTTGAGCTGGGCGTTGACGGCGATGGCCGTCGGGTCGCGCTGGTTCTTGGACAGCAGGCGCATGTGCAGCGGCA
CGTCGTCCGGGTTCACGGACAGCGCGTACCGGGCCGGCAGGCGGCGGAAGTGGGCCTGCACGGAGGCGAACACGGGCTCGTACAGGTGGTTGAGCACCTT
GCGCTGGCCGTAGGAGCCGGACGCGGACACGTACACGTCGCCCACCATGTGCTTGACGACTGCGCGGCACATGTCGTTGACCACCGAGTCCTTAAGCCCG
CGCTGCACGCCGAGCGCCGACGGCTTGGGCGCGACGGGGAAGTAGCCCTTCTTCTCCAGCTCGGCCAGTGCCTGGTAGCTCTGCGCCTTCTTCATGCCCG
TGGCGGGCTCGCTGGGCTCGGCGGAGCCGTAGGAGCCGGACTGCGCCTTGGTGAAGGGCGCCGGCGGCTGGGCCGCGTCCAAGGCGGCGATCTTCTGCGA
CAGCAGGCGCGCGCGGGCGTCCACGTCCTGCGGGACGACGGGCGCGGCGGGCGGCACGTTGG