Description :
From Genome Similarity Track
Location :
Scaffold_140:57835- 64272
Transcript NameFunction/comments
Albla_Nc14081520

Sequence
6437 bases(100 bases per row)
GGTGATCTTGATAACGATGAGATTTCGATCGATTTCTGTTGCGATCTGTTACATGTGAAATTTGGATTTCAAGAAGGGTCAATTGCGAATCAACGAGAGC
ATGTGCTGCTATTATTAGCCAATGCAAAAGCACGCACAGGCTTATCGGAACCTGTGGATCACTATATTAACCAATTACATTCCAAGTTATTCTCTAATTA
TAAAGACTGGTGTCAATTTCTGTCGACAAAAGCGGCGCATTTCGAATATGACCGACAAAAAACACAAATTCGACATCCTTTTCACATGGAAATTATGCTC
TACTTTTTGATATGGGGTGAGGGAGCCAACTTACGACACATGCCAGAATGTTTGTGTTACATATATCACAAAATGCTGCTTTTGCTGAATGAGAGAATCG
CATTGCCAATCACACAAGAGGAAGGTTGGTTTCTCAATGAAATTGCTCGTCCAATATGGAAAGTATGCAGTAATATGCAGCGTCGTAATACACTTGGAAA
GCCATTGGAACATGTTCAAGTTTGTAATTATGATGATATTAATGAGTATTTTTGGAGACCGCACTGTTTACAAGTCGATGTAACTCAAGTGGGTTACGAA
ATGACGAAATCACACGGCAAAACATTTTACGAACATCGAAGTTTATTTACATTTATGCTCAACTATTACCGCATCTTCCAATTCAATTTCATGTTTTTAC
TTGCATTAATCGTATTGGCTTTTGCCGTCACAATTTCACCCAATGGCGGCCACGATGGATTTTCACAGTTTGGTCGTCTGGGAGAGACTGTCTCGCCATT
TACGTCTCAAGAACTTCATTTGGCTTTATTGTCACTTCCATTTGGACTTGCGTTACTCTGTCTGTTCAAATGTCTGTTGGAATTGGCTCATTCCGTTCAT
ATCATTTGTTCTCGTGAGCCATCTTCCTCTTCTTCTCGGTCGTTTACATACTTTACGGCTCTGTGGATTCGAATCATTTGGCATTCAGGCTTCAGTTTTC
TTTTGGGATTGATGATTGTGATCCCATTTCGTGACGCTTCCAATACAAAACTGCTGGATTTCTGGGTTTTAGCTGTTTTGATCTATTTGGTCCCTGGAAT
CGCCCTCGTATGCGCCAACGCTTTCCATCCTCAATTGATATATGCAACGGCTCTGCGGAAATTTGTTCGTGAAGGTGATACATGCTATGTGGGTCGAAAA
ATGACTCCTCCATTTGTGTATCGTGTCCAATATACTGTGTTTTGGCTCATTTTATGGACACTAAAAGCCATCATTTCCTACTTTATCCTCGTTCGACCAC
TTATGCTTCCGTCTTTGGCAGTGTATGAAATGAACCTCGACTACAAAGTATCGCTAGTATCATTCAGCAATATCGGTGTTCTGGTCGCGTATTGGGCCCC
GAGTGTCTTCATTTTCAATTACGATACGCAAATCTATTTTACAATTTTCCAAGCTCTTCTGGGCGCATTCCAAGGCTGGCGGATGAAAACGGGGGAAATT
CGTGGTGAAAAAGAAATGAGTAAAGCATTTCGTTTGGCTCCACAATTATTCGACCAGAAAATTGTTACGGGTTTAGCAAGATCCACCGATGCTGCTGCCA
CCGGAATGCATTCCACTGGAAAAGCGGGCACAGTGGCCGCGTATGAGAGTCAGATGATGCTTCGATTTGTGGTGGTGTGGAATGAAATCGTCAATTCGTT
CCGTGAAGGCGATTTACTGGATGATAAAGAAGCAGCAATCTTACAATATGATATTCGAAGCAATGGCGAAGTCTTCGAACCCGTATTTCTATCTGCTGGA
AAACTATCAGAAGCATCGGCTATAGCAATCCGAGCCGCCAAAGAAGGGAAAGGCGAGTCACAGTTTCAAGTGAGTTTGGTGGAAAGTGATTGTTTATCGG
CTATTCGAAGCTTCTTCACTGCCAGTTGGTATGTTTTGGAGACGCTCTTTGGTAATCAAGATGCTAATGTGCTCGATGGAATTCGAATGATTGAAGAAAT
AGCATCCAATGGTGCGTTTATGCGATCATTTCTCGTCACCGAACTTGGACGACTTCGCGTGGCGGCTCTGGATGTTCTGGAAGAAATTTTGGATCTTCCC
GATCCTGATACGCAATCTACTCACCTTCCAGGCGCTTACGTCCACAATATGGGTGTTATTCGTAATTTTGTGAGCAGAATGGAGGTGCTTTTGTCGAGTT
TGGACACATTTTGCACTGCTCCGGAGCTCCAAGGAAAATTTCTCCATACGAAATTCTGCTCGAGTTCTTCGGGGTACCTGGTTGCTGCTCAAGGACTAGT
CAATTTATATCAGAGCGATGTCGCGATGGGGGCAGCTACACGTGCTTGTCTTCTCTTATCACTTGATAAAGCGGAGGCGATGCCACGTTGTGTCGAAGCC
CGTCGTCGTTTGGGCTTCTTCATGAAGTCTTTGGTGATGGAAATTCCGCAATTGAGCTCTATCCACGAGATGCGTTCCTTCTCAGTAGTGACGCCATTCT
ACGCAGAGACGGTTCTATTCTCGATCCAAGACCTTAACAATCCGCTGGTGAATCATCCCATTTTCCAGAATGTCGAGGAAGGCGGGAAAAACTTGACAAT
TTTAAAGTATCTGAACAAAATCCACCCGGAAGAATGGGAGAATTTCCTGGAGAGAATTGATGTCGGAAGTGCTGAAGAAGCACAACAACATTTCCCGCAA
GAAATACGACTTTGGGCATCGTACCGAGGCCAAACATTAGCACGTACCGTCCAAGGAATGATGCTTTATGAAGAAGCAATCAAGATTCTTCACTGGCTCG
AGATTGGGTCCGGGCACGGTCGAACTGCAGAGCAGAAACAAGAACAACTGCAAGATATGGTTCGACTTAAGTTCTCATACGTATGCGCCTGTCAAGTGTA
TGGGAAACATCGGGCTGAGAATCAAGCTCAAGCAGATGATATCGATTACCTCTTGAAGGAGTATCCAAACCTTCGGGTCGCGTATGTGGACACTCTGACG
GATTCGAACACAAACACTAAAGTATATGACAGTGTGCTGATTAAAAGTCAAGGCCCGGAAATTGTTGAAGTGTACCGATTCCAGCTTCCCGGGGACCCTA
TCATCGGTGAAGGGAAGCCTGAGAATCAAAATAACGCCGTTCACTTTACTCGTGGGGAATTTGTGCAAACAATTGATATGAATCAGCAGCACTATTTTGA
AGAGTGTTTGAAAATGCCTCAACTTCTACGAACTGCAGAGCTTCATCCGTGCAAATTACCAGTTTCTATTATCGGGATGAGGGAGCACATCTTTACGGGG
AACGCTTCCTCATTAGCGAAATTCAAAACGTGGCAGGAATTGGTGTTTGTGACGTTATCTCAACGCGTGTTGGCGACCCCGCTTTACGTCCGCATGCATT
ACGGGCATCCTGATATTTTTGACAAAGTGTTTGCATTGACACGAGGCGGTCTATCGAAAGCGAGTAAGGGAATCAATCTTTCGGAAGATGTATTTGCCGG
ATTCAACGCGACATTACGTGGCGGTGTGGTGACGCATGTGGAGTTTATGCAATGCGGAAAAGGTCGAGATGTCGCATTATCTCAAATCTCCATGTTTGAA
GGGAAATTGGCCAACGGTGCAGGAGAGACTTCTTTGGCACGTGAAGCCCACCGAATGGGTCAATTTATGGATTTCTTCCGACTTAATTCGATGTATTACT
CGCATACGGGCTTTTACTTTGCGACTTGGATGACCATTGTCACGACATTTGTGTACATGTACTCTAAAGTGTATGTGGCATTGGCCGGTGTGCAAGAACA
AGTGATCCTCAAGATGAATAGTACCGACATTCTCACGCGGAATGAGGCGTTTGGATTCCCAACTCGAGCGTATGAAGATAGTAACGACATCATAAATACG
CAGTATTACATCCAAGCTGGTTTGTTTCTTTCGCTGCCTTTAGTTATGGTGTACTTTGGCGAGATGGGCATTCGTCACGGGCTACTCCGTTTGATTGAGA
TGGTAATCACTGGCGGTCCATTCTTCTTCATCTTCCAGGTCGGCACTACGATGCACTATTTCGATAACAATCTTGTGCACGGAGAAGCTCAGTACAAAGC
GACCGGAAGAGGATTCAAAATTACTCGGGAACTGTATGTGCTGCTCTATAAAGCGTACTCTGCCAGCCACTTTCGACGAGCATTTGAGCTTATTGGATTG
TGTCTTATCTATTGGATTTTCGGCGACTTTCATATTTGTCAAACGGAATTTCTCGTGGATAACTCATTTGCCGCTGATTTTTGTAAAACTGCGCAAGGAT
TCGGCGTGCAAACATTTGCGATTTGGACAATTGCAATGACGTGGATTCTCGCTCCGTTCCTCTTCAACACGGACGGTCTCGACTTTGAGAAAACAAAAGC
GGATGTGAGAGCATGGGCAACGTGGATGTACGCGGAAGAAGACTTTTGTGATCAAGATGGGACCATGAACGGAGGCTGGGTGGGATGGTGGAAAAATGAT
CTCAAGCTGTTCCATAATTCGAGGCCTATCGCTCGATTCACAGTCATTCTTCGTGAAAGTCGTCATTTCATTCTTATGTGGTACATTATTACTTTACGAT
GGGAAATGGTCGCGGTTGGGGTCGTTGCTGGATGTGTGCTATTGACACTGATATTTTTAAAGCTCTCCAGCGGCATTGGGGTTAGGATGCGAGCGTGGAA
ACCACGTAATCGCTTAGTGGCATATTGTCTCACACTGATGGTCGTGGTTGTCAGCTCCGTGTTAACGGTCTTATTAGGCTTCCAGGCTGATGGGAAGGAT
GTAATGTCGTTGTTTTTCGGGTATATGGCGGGATTATATGGACTCAATGAGACAGCCAGAATGTACAGCTTTGCATCCGCATCAATCGCGTCCAGTATCG
TATTTCAACAACTGGCATTTCTGTTCGATTTTCTTTTTTGTGTGGCAATGATCATACCTCTTTTCGTCATGTCAGGCGTTCCGTTCCTCAATATCATTCA
GACACGAATGATGTACAACAAGGGATTCTCACAAGTGGTATCGGCTTCCTCGCAGTATGCGTTCTCGTTGGCCGCGTATATGGGCATTTTAGGTGGCGGG
GGATGTGGGTGGATTCTGTATGTATTCTCTGTCTTGGAATCTTCGCCAGAATTCATCAGTTATGCGACCAATTTCGGCTTATTGGACGGGAAAGCCGGTG
ACGGCACATTCACATATGTCTTTTACATTGCCTGTACTCTAGCATCGCTTGGTGGAGGTATTCTCAACTTTTTCTTCGGACGTCGGCTTTCGATCGTATG
TGGTGGACTGGTGACTGTCATCGGAATGATTTGCATCACTGCTGCCGCCTCTCATGGCGATGGAATGTTACTGACTGGAATGGCGCTTATGGGCTCATCG
ATTGGTATTATCCTCCCAACAATTGCAGTGTATGTGTATGAGATATCGACCCGCGAAGTTCGGAGCAAATCGCTTCTTATTCTTGGAACAGGATTCATTT
TGGGAACTCTTGTGGGCACAATCTGCATGTCTTCAAACCACGAGACTGGTTGGGTGTGGCAAATCTTCGTAGCAACGATTGCGTTGTCGTTAGTGACACC
TTCTGTGTACCTCTTTCCTGAAAGTCCGTATTGGATTTACATGCGTCACGGACTGGACGCGTGTGAGCGGTGTTTAATCATCCTTCGACGCAAAGAAGGT
GTCACAGAGGAGCTCAAGAGCATCCGAGAAGAGACTCTTGTGGATGCTCGTGGCAGTTTAGTGTACAAACTGAGTTTGGGATTGACACTTGTACTTCTTT
CTGGGTTCTGTCATGGCGGTCTTACGATCTACATGACACACTCTTTGGAATCGGTGGCGAATACTTGGGATTTCTTTGCGAATTGTATCGCATTACAGCT
GGTGGGAGCCATCATGTCCTTCTTTGTGATTGATCGTATAAGTCTGCGTCGATTGTTGTTGGGCACATTGTTCCCCATTGCAATTTGTGTCTCCATTCTG
GGATTTTACGCCACCACATCATGGTCTGATCGTTCTGGACTCATCCTTCTGCAAGTAGTGGGTCTTGTGCTTTACTTTTTCATTGGGCTTGGGACGTCTA
CATCACTTTGGGTGTCGTGTATTGGCTTGTTCCCGACAAAACAACGCGCTGGAGTGGCGATTGTATACTTCATGGTGTACTTTTCTGTAACTTTGGTGGC
TGTGTATGTGCGTTCGAATTATTCCAGCGGCCATTGGATGGAGAGCATCTACCTCTTTGTGATGGCAGGAATGTGTTTAGTTGCAGTGGTTCTTCTCTTC
GGTGCTGGGGATTTGAAGAATGGTCTTATTAGCACAAAGCGAGAGATGGAATCGGAGCATACACGGCTTCGAAGAATGCGGTCTGGGCGACCGAGTGGAC
GATCTGGTGGAGTCGCTCGAAGTCGTAATATTAGTCG