Description :
From Genome Similarity Track
Location :
Scaffold_1:5783272- 5806004
Transcript NameFunction/comments
Physo_471739chromodomain-helicase-DNA-binding protein, putative
Physo_310819Hypothetical protein
Physo_248430CN024 protein
Physo_360101predicted protein
Physo_310811PREDICTED: chromodomain-helicase-DNA-binding protein 2
Physo_310822FGFR1 oncogene partner
Physo_476703Hypothetical protein
Physo_355160Hypothetical protein
Physo_468609ATPdependent DNA helicase putative

Sequence
22732 bases(100 bases per row)
CAATTCATTGAATTGCACCATACAAAGTCCAAGCCATTTCTGTTCATTGGTGTGTGCCACATAGCTCCGTGCACTGCGCCATTTCGCGGTTCGACAGCGT
ACGAGAACAGCGCGCCCTGCCAGTCCCTGCGGCTGCTCCACCGCTGGCGTCGTGGACCCCAGACTCGCTGCTGTTGCTTCGTCTGCGCGGCCACCTGCGA
GGCCCATGGAGAGCGCCACCCCTGAGCCAGGTGCGTCCGCATGCATGCAGAGACTGCGAGGAATGGGTGGAGGAGGCCACAGAAGCCGCCTTCAAGGCCT
TCTGCCTCTTCCTTCGTCACGATTACGCCCACGCTATTAACTATAAATGGGTTAAGTTGTACTGACGCCGCTCGTATTTTGCTCTTGACGTATCGCCAGC
GCCCGCACCGCCCAGCGAGCAGGAGAAAGCCCCCGCCGCGTCTCCCGCCCCAACGGACACTCCGGAGCCGAAGGTTAGCGTTGCCGAGCCGAAGTCGAGC
CCAGTCAGCTCCAGTACAGATGCGTCAAAGGAACAGGTGAAGGCAGAGGTACAAGTGAAGCCGGAGGCAGCTGCAGAACAAGTGAAGAGCGAGGATGGCA
ACCGTCGGAAGCGCCACACGAAGAAGGTGAAGTATGTGGAGGAAGACGACATTTCAGAGGGCGAAGAAGCCGCCATTGCTGAGAAGAAGAATCGCGCTCA
GCGGCTTGACTATCAGTTGAGGACCGTACGTGGCTTTTATTTCTGATTCGGTTGTTGTGTGACTTCAAGTGGCGATCATTGATTATTATTTTTTTGTTGT
CCTTGATTAGGATGTGGGCTACCCGCAATTGGACCAAATTGTCGGACGAAGGATTAACGAGTCTACGGGGCTTGTCGAGTATCTGTGCAAGTTCCTGGGC
CGATCGTACTTGCATTTGTACTGGCTCACGTTCGACGAGATGGAGCTGTTCATTCCGGAGGGATACCAGAAGTTCCATCGCGTGCACGTGTATGACCGCA
AATTGAGGCGCGAAGGATACCAACCGCTGGATGAAGTGGATGATTTAGAGGCCAACAAGTTGACGGTGGAGAAGATTCTGAACCACAAGGTGGACCCGGC
TGACCATTTGGACGAGCAAATTGAAAAGCGCCGACAGCAGCTTTCGTATGAGCCCAAGTTCCCGCGTGTGACAGACTATTTCTTGATGGACAATGCTGAT
GCACTGTCGGAGCGTATGTTGGGCATCGTCACGAAGCTGACGAAAGAACCCGGAGGAGATATTTTTGAACACCCTGTCGATGTTGAAGAGGTTCCCGATT
ACCTGAACTTCATCACAAATCCGATGGATCTCGGAACGGTCGCTACTCGAATTGGTCGTGAAAGTTACTACGTTGGACCATCGGCCACGTCGTTGTTTGC
CTCGGATGTCAGATTGGTGTTCAACAACTGCAAAACCTACAATGCAGAAGGTTCAGACATCTGGCGCGTTGCTGACGAGCTCCTGCGCTGTTTCGAAAAG
TGGTTATACGACTGGGTGCTGTCTCCGACGGCGTGGATGAAACTTCCTCCTACGGGAGATGCGGAGCAAGATCAACAGCTTCAAAAAGAGTTCCGACGTG
AAGCTGAAACTTTTTACGACGTTTGGGCATCGTGGCAAATTGGCTGTTGTGTGTGCGGTAACAATGACCACAGCGAAGAGCTATTGTTGTGTGATCGGTG
CGATGGTGAGGTGCACATGCAGTGTGCTACCCCCAAAGTGACTGAGTTGCCTGAGGGCGAGTGGTTCTGTGGATACTGCCGGGCGCGTTCTAAGTTTATT
GCGAAGGTGGAAGACGTGAAGCAGGAGATCGCTGAAAAGAAGTCGAACACCATCGATGCTGTCCCATCAGGTGCTACCGAAGACAGTGCCCCCTCGACCT
CGAATGCGTCCCAAACTGCTCCTTCGGACGAGAAGACGGTAACTACTTCAAAACACATCCCGAACATCATTACGGAACGTGTCGATGGTGACGGAAAGTT
CAACAAGAAAACGAAGAAACGAAGCCCTAAAGGAGCTAGCGCGACTAAGAGTTTAGCTCCAATCAGCGTGAAGGATCGTGCCGCCACATTTTTCCTGGTC
AAGTGGGTGGGCATGTCCGTTCGATTTTCAACCTGGGAACGTCCTGAAGATATCGGTGACGATGAACAGATCCAGAGATATTTCAAGTTCAGCCGCGTAC
CTAGTGCCAAGGAAATCAGTGAAACTACGTGCCAGTTGCCGTGCTGCGCTAAACGGCACCAGTACGCTTTAGCTAATAGCACGAGCGGCAAAAAATGTTG
CGAAAAAGACCGCTTTTGCACTCTGGGGTACGGCCACGAGGGTGACTGCAGTCGCAGTATTAAGGCGCTGGGCGGGGCATACGGTAGCAGTGCATACCAA
CGACTGCACATGGCGGAGCAAGTGAAGGCTCAACTGTTTGCCTTTCATTGCTTGCTGAATAACCACACACCAGACAAAGATGTGCTCAAACAGTGTGGAG
TGTACACAAACGCGTACGTCACCACGAAGCAACATTTCGCACCGAAAGCTGTTAAAGACGACGGCGATGAAGATTATTCAGACGAAGATGGTGATTCTTC
CGACGACGATGCTGACTTTGACGCCGAGCTCGACTATCCTAATCGACCCGCTTTGTACCCAGGAATCCTGACCCTGGAAAATGACGACGGCGAAGAGGAG
GACGGTGTGGCTGCGGGTCATAAAAAGAAACCAGAAGAAGAAGTGGGTGAAGTGCTTAGTTCACTTGTTGAACATGTGGCCCTTGGATATCCCACTAAAC
TGGAGACCGTCAGCGCTGAAGTTCGATACGATTCTAGATATCCTGCAACCACGTTCGGAACCCGTCAAGCCTTCACTGAGTATTGCGTTGTGCTCGGTCG
ATCTCCATTCGGTCTCGGAATGCGCCTTGGCATTAGCAGCTCTAACAGTGTGTCGGTGCTTGGATTTCAGATTCTCGCAAATGGTATGATCGGCCCAGCT
CAGGCATCTGGCGCCATTTCAATCGGGGATGTGCTGGTTGCCGTGAACAACGTTTCGGTGGCTGGGCTTTCTTTCCAAGACGTAGTCAGTTTGATCAGCG
CATCTCCCAGCAGCATCTTATTCCACTTCCATTCCCCGAGACCAGCGTTCATGTACCCGCCGTTTTGTCAAGCTAAGCAAGTGACGATGACCCGTGTGGA
ACAAATTCCCGACGACGCGATTTCTGAAAACTCCAAGTACGCAAACTACAGTTACAACAAGTACAAACGGATGCTCAAAGTGGGAATTGCAGACCCAGAG
GTTGCATCGTCAGCTTCAACTCAAACTTTGATGCAGCACTCGAACTATATCGCCCCGAGCGGACCTATGCAACATCTGTATGCTGGTGTCGTCGACAACA
GTATCGACCCCCACGAGCATTTTGCTAGTTTCCTCCCGGAGCGCAGCAGTACGTCAAAGAGTGGACCGCGTGGTAGTGGCTCTGGTCCAACTGACCGTGG
AGATGCAAATGAGTTCGTGCCATACGAACAGTCGCCAACATACAAAGGTGGCCGTACGTTGCGACAATATCAAGTTGAGGGGCTCAACTGGATGGTTTCC
TGCATCAAAGCCCAGCGATCGTGCATCTTGGCGGATGAAATGGGACTGGGTAAAACAGTGCAGATTGTGTCGCTGCTTGAGCATATGAAGTCGGAGGAGT
CGATCCGTGGGCCGTTTTTGATTGTTGTGCCTCTGTCCACGATCCAGCATTGGCGTCGCGAAATTGAGAGTTGGACGGACCTCAACGTGTGCGTCTATCA
CGATATTGGAGATCGTACCACCAAGTTTAATGCTAAAGACATGCGAGCCGTCATTCGAAATCAGGAATGGTATTATCCTGGATTGGGCAACTCAATCTTC
AAGTTCCACATCCTGCTGACTACGTTCGAGACAATTTTGGCAGACTTTGAAGAGTTCGAGCATATTCACTGGCGTCTGGTTGTGGTGGATGAGGCGCACC
GTTTGAAGAGTGCAGGTTCTCGGGTGCTAAAAATGATGCGTGTTCTCCATGTTGATCGCAAGGTGTTGCTGACAGGTACACCCTTGCAAAACAATACCCA
GGAGCTGTGGGTCCTGCTGAATTACCTGGAACCGGTAAAATTCGCGAGCCTTGAAGAATTCAACGCGAGTTTTGGGAAGTTGCACTCACAAGAACAAGTT
GTCAAGCTTCAGCAGTTGTTGGCACCTTACATTTTACGACGCGTGAAAGAAGATGTGGAGAAGAGCATCCCGCCCAAAGAAGAAACAATTATCTCGGTGG
AGCTTACGACACTGCAGAAACAGTACTATAGAGCCATCTACGACAAAAACAAGAGCTTTCTGTACCGCGGCACGAAGAACGGCTTACCCACGTTGAACAA
CATCCAGCTGCAGCTTCGAAAGTGCTGTAACCATCCATTCCTCATCAAGGGTGTCGAAGAACGAGAGCTAGAAGAGCTCGGCAGCCATCCAACTCCAGCC
CAGGTGATGGAGAAAACTATTGAGTGCTCTGGCAAGATGATGCTCGTGTCGAAATTGATCCCGAAGTTGAAGCGGGATGGCCACAAGATTTTGATTTTCA
GCCAGTTCCTGAAGCAGCTAGACTTGCTCGAGCGCTACTGCGAGGCGAACTCTTTTGTCTACGAGCGCCTCGACGGATCCACTGGTGGAAGTATGCGGCA
GAGTGCAATCGACCGTTTCTCTCGCCCACACTCGAAGTCTTTCGTGTTCCTTTTGAGCACAAAAGCTGGCGGCGTTGGAATCAACCTCATTGCAGCAGAT
ACGGTAATTATCTTCGATAGCGACTGGAACCCGATGAATGATTTACAGGCGCAGTCGCGTTGCCATCGTATCGGTCAGAAAAAGAGTGTGCAGATCTACC
GGTTGGTGACACGCAACACGTACGAGAGCGAAATGTTCGATCGTGCTTCACGAAAGCTTGGTCTTGAGCATGCAGTGTTGGGCACGGCATCCTTCAATGA
GAATTCGCAGATCACGAAGCCGTCAGCGGAGCAGCTAGTGGAATTGTTGAAACGTGGAGCGTATGCGCTCATGGAGGATGACGATACGGCATCTAAAGAG
TTTGCTGAGCGCGATATTGAGACCATTTTGAAAGAAAACGCCCGTGTCATGATAGTAGGTGGCGGATCTAATGCAAACAAGGGGGCGGATGGCGATGCGG
CTGGGCCGACATCACCTCGACAGAGGAAATCGCCGCTGAAGTCAAACAAACGCAAATCGCTTGGTGGAATGGCGGTGGACCGTTCGTCTTTTGTTGCAGA
GGGATCCACAGGTGAGCTTTCTGTGGACGACCCCAACTTTTGGGAGAAGGTGCTCCCTGGTGCTGTGTCGGTGGAGATGCTGAGCTTGAAGCTTGAAGAT
GGCAGCGCTGTTAGCTCTCGCCAGGCGAAGATTAAGTTTATCAGTAATCTGGACATCGCTCTCACCAGCTTGGTCACTGAGATGAGCTCCGGCAACAGTG
CGGACGATGGTCGCGTGGGAGTTCGAGATATTCAGCACGAATATGATATTGCCATCCAGGTGCTGAGTACTGTAAGCTCGAAGTACCGCAACGAGTTCTC
CAGCGAGCAGATTGATCTCGTGAAGGGGTACTTGTCAAAGCTAGAGAAGTCACGGGTCCGAAGCTGTCGACTAGCGCCATCTCGGACGAATATGTTCCAG
GATGAAGATTTCGACACTCCGAAGAAGAAAAGGCGAAGGAGGAGCACGCCCTCGGGAAGCAGGGCGGCTAGTAGTGAGGATGAAGCATACGGTGATACTC
CAGTGAAAAAGCGCGGTAGCAGACCTCGTGGAAGGCCGCCAAAGCACCCGCGAACTGAAGGTGGTAAGCCTCCGACTGCTCTTTTCCAGGCCGGCGCTAT
TAACGACAGCGACGATTTGTGTACTCTATGCGGTGATGGCGGATTAATTTTGCTGTGCGATGGCCCCTGCCATCGCTCGTTCCATCTTGAGTGCGTGGGG
ATGAAAGACGAGCCCAACGACGAGCAGTGGCTGTGCCCAGATTGTGCGGAGGGGCGTCACATGTGCTTGATTTGTAAGCAGGTTGGTGAAATGGGTGTGG
AATTCGGTGTCACTCAATGCTCGGTAGCGAAGTGTGGAAGGTTCTACCACAAGGGCTGTCTTGCTAAGAGCTCCCGTGTAGAGTGGGTTGGCAAAAAGCG
GTTCCGTTGCCCGAGCCACTTTTGCCACGCTTGCTCCCAGGCCAGTAAGAAGGAATCCGCCGCCAAAAGCAAGAAGAAAAAGGATGATGTCAAGACACAC
GTGGTGAGCTGCATCCACTGCTCGCAAGCCTTCCACCCGGAGTGCATTCCATCAGCGGACAAATTCATTCGGCTCTCAAAGAACCTCATGATTTGCGCGA
ACCATCTCGACGGGAAAAGACCACCACAAGCTGCTGCAGGGAACGCATCTCGATCGGGATCTACGCAGCGTGCTGGTGCAGCGCTTGCCGCTGCTGCAGC
TCAGCAGCGAGAGGAAGTTCCGCAGCAGATACCTCTTGATGAGGACGACGAACTTGATGAGGACGTATCGACGGATAGGTCAAGCGGCAAACGCAAGCGT
GCGTCGTCGCCGAAAAGGGCGAGCAGTTCTGGCGCGAAGAAGAGCAAATCTACTCATTTGGATGGTGCAGACAAGTCGGTCGTGAAGCCCAAGATCTGCG
CGTTGTGCCACCGCGGAAACGTAATGGGAGGGGGCGCAGACGGCCATGGCGCAACGTCGGCATCGTCTTCATCCAAGAACGGAGCGCGCAATGGAAACTC
GAGTACGGACTCAACGGGCACTGCTACGGCTGATATGGCATTAGAAGGACCATTCATCGAGGCCCCGGTGCGGTTAAAATACGCGGACAAGCCCAATGAG
TCGGTGTATGTTCACTTGAACTGCGCCGTGCACTCGCCAGAGGTATACGTGAAGGCGGATGGACTTATCATGAACTTGCCGAAGGCAATCAAGCGCGGGC
GTCAGCTCAAGTGCACCAGTTGCCATAAACTCGGCGCCACCGTTGGCTGCGTCGTGGCGAAATGCCGGCGCAATTACCACCTGCGCTGTGCTGTTGAGAG
CGGCGGCGAGATTGACGGCACGACGTACGCCCTGTACTGCAAACCGCACGCTGCTGCGCGCAAGGAACCGACTCGTGTGTGCGTGTGCAGCGCCAGCGAG
GAGGACCCGGTGCTCACACTGGTGTGCTCGTCATGCTGCACCAAGTTTCACCCGAAGTGCGTCAACATGTCGGAGCGCCACGCGGCTCGCATGGCGAAGA
CGTGGGTCTGCGGGGTCTGCGACGGATCGGCCGCAGCGAAGCCGATGACCCCGACTCACGTGCCCGCGGCCAAGGCAAAAACTACAGTGTCGAAGAAGGC
AGCGACCAAGCCAGCCAGCTCGGAGGATCCTGCCAAGACGACTAAAAACCCGGCATCGAAGAAGAAGAGCAATGGCAAGGCGGAGAGCGTCGACGCAGCC
GAGCCGCCCACCACTCCGAAGCGCAAGAAAGCCAAGAAGAACCGCCTGAGCATGCCTCGGAACAAGTCTCGGCCCAAGTCGAATGACACGACGCACGGGA
TTTCGCCGCACATGGACGCGGACTCGGACAGCGGCGTCTCCACGGACGAGTAGGTAGAACCAAGGTATGAAGGAAGACATGAGCAATATATGGTAATACA
ACTTCGGTCGAATGGATCTGTGCGATGGATCAATTTCACGATAACGTGCAGCAAAGCTCGAAAGGAAACATTATTTTTTCATGATCCAGCTCGCTTTCCT
TGATCTTTTTGATGAGGATGAAGATGTGTATTGAATTGCTTGAACGAAAGAATCGTAACACCTACGGGTCAAAAGACCAGCAACTCAACATGCTGCCTCA
ATGGCTACAAGTATCAAGTTGCCCACGCGACAGCATGTACCGGTAGACGTTTTGAAGCTTTCCAGTGAGGGTAAGCTACAGTATTTTGTTAAAAATCCGA
CCCCAGAATTGTTGCCGAGGTCTTCTGTTGGTCCGTAGCGAGTATCACACAATCTCTGTTGGAGCTCGGGTGATATGCATCAAGCTACTCGAATCCGAAT
TTGCTCGCCGTCTGCACTTGAAGTACCTAGATCTTTGCGCTCGTACGTACTTGCCAGTGGCAAGTTGCCACCACCGATGGGGGACTCAGCCGCAGAGGGT
ATAGTATCCGCTCTGCGAAAAATGTCCGACTTGAACCGTGCCAAGTGCCCAGCGCGATGGCCAGGGGCGTCACGCGTGGTGATCGCTGGGCTGGTGCGCG
TTACGCACTGCGCCAAACTGCACTCATGGCCGATCGATGCACGCCAACACAGCCCGAGCTGCCAGCAGTAACGCTGTGGACCCGTCGTCCCGGGCTGGAG
GACATCGCAGGCGAAAAGGGGACGCATGGCGACAGGTGAAAGCGCTGACCAGAGACTCCCCCATCGGTCGGCTGGACGGCGGCAACAGATGCTGTACTCT
TGAATCGGATTGAGCGAGGGCTACACTGGCGCCTCCAACACTTGCAGAGCGGCCAATTTTCTGCCTGCAATCGACCCACCGAGGTTGCCGTTGCCGTTGA
TGGGCTGGGCTAAGATCGCCGCCGAATATCTGAAATGACGCCGAAAAAAGAGACGTTCTACGCTTTCCCGCCTTCTGATTGGTCAGACGAGGTTCGATGT
TGAACTCGAGCATCCTCGATTGAACCGCTTCGTCGGACGCGTTTTACAAGGCGAGTCAGTTACCCTGCTTTCGGTCGTCATGAACATGCCTCGCTGGGTG
TGTATGTGTGAACCTCTGCGATGCATTGGCGAGTCTTGGGAGAGACGGTTAACTATTGCTTGCCTCTGCCATTGGGGGCTCGAGCCCGATTTGCTCGGGC
TTAACAGCGCCCTTCGCTGTCAGAGTATCTAACGCTTCAGGCCAGTTTTGGGCTCGGGCATGTCACGCCGGAAGCCATCTGCGGCGCACAGGGTAAAGCC
CACCGCGCCCGAACTTTAGTGGTCGAGGCTCGGTGTGTGATATGAAGGCTCTCCTCTCCCCCTTTACACCCTTGGGCTGGTCCCATTTCCCAACTTACTT
GCTCTTGGACTTGCCCTCGCTCCGTCCGACGGCATTTTCCTGCTTCCTTGCTCTCGGGACGCGCGCGAAACGAACGCGGTGCCGGCGCCTTCCCTTGCAG
CAGCAACCTGCGAAGTGGCTGAGCCTCGTCCACGAAACTGAGCCAGTCTCGTCGCCACCAACTGCAAGCAGCAAGCAAGCGGCTCCCGCTGCTCCGTCTC
TCACCGGCGAGGCAACTTCGGCAACCTGGAGCCGAGTGCTTCGCTTGGTACCGTCCCAACTGCGTTTCGCCCGCCCAAGATAGTCCCCATCGCACTCGGC
AATTGGCCCGCCAAGCGCCACCCTGCGCCAAGAGACACTCGCTGCACACTCGACTCAGGCTGCAAGTTGCGATCCGCCACGCCACGCCACGCTAGCGCCA
ACCACCGGCAGCAACACAGCAGCGGCACCGAATTATTTTGGAGAACGACGACGGAGCCCAGCAGACCATCCCCCCATCAGTCGAATCAGCTCCATCGCAT
CGCACCATCTAGATGCCACTTTCCATCTCGTTTTACCACAGCAAGCGCGGCGAGAACGTGGCCAGCTCGTACCAGAGCGTGGCGTTGCACGACCGAGAGA
AGGTGAAGCACAAGATGGCGCTGCCCTGCGAGTTCTACCGCAACATTTGGGGCCCCACGGAGGAGGAGGACGCCGCGCTGCGGCGCCGCGCCAGGTCCAG
CAAGTTCAGCAGCTCGCCGGCCTCGGCGACGTCCCGCAGGTACAAGAAGAGGCTGGCCACGGGGCCGCTCGTCGACATTGCGCAGGTGGCGCACGTGGTC
ACGACCATGTCGGACTTCCGCGCGGACTACGGCGAGGACTCGAAGCGGGTGCGACTCGTCAACATCTGGGACGACCGCAGTCTCGCGCTGGGCTTGGAGC
CCGAGTCCAGCTCGGACAAGTCCTCGCGCAGCAGCGGCGGCAGCGACCAAGGGCCGTCCACGGCTGACACCGAGCCGGAAGAAATCATGTCGCCCATCAG
CCGAGCCGACCGGATCACAGAACTCAGCTGCGAAGACAGCGACGACGACCTCAGCAGTCTAGCTTCGTCTGTGGTGAACCAGCGGCCAGGCCAGCTCAAG
CGAACCAAGACGCCGGAGATCGTGTTCCCCAACAACAAGAAGAACGCGAACATGGGCCGAGGCAATGGCAATGGCAAGACGGACAAGAAGGAGCTCAACT
TGAAGAACCTGCCGGTCCCTCCTCCGTCGTCCCACAACGGCAGCATCATCTTCAGCGCCGTGTTCTCGGAGCAGACTGACTGGAGCTGGAGCGCCAAGTT
CCTGCTGGGAATCCACGAGCCAATCCGCCACGCTCTCTTTGTCATGGATCGGTTCTTGGAGCAGTCGCAAACTCGATCGAAACCTGAAGCTTCGCAGACG
TTAGCACTCGAGACGCACGTGGCAGAGTTTTTCCTCTGGTTCAAGGCGTACTTTGTGGAGTATTTGCAGTGCCAGCACGAGGTGAAGGCGTCGGTGTTGC
TGCCGCTGCTGAACCTGCCTGTGACGACCAAGCAGCAGATTCTGGACGTGTATCAGGATATCTCGCAGATGCTGACGCAGATCCAGCAATTGGAGCGAGC
GTTGTGTGTGAGTGGGGCCTGCAGTGCGTCGTCCTGGCTGCTTCGTCTTCAAGTGTTGCAGACAGAGATCCGCCAGCTCAATCGGACGCTGCATGCAGCA
TTAAACATGGAGGAAACGACTTTGCACTCGGCCATGAGCGCTGCGTTCACCGAGCGCGCTTTCAGGACACACATCATGCCCCGGGTATTCCGCGCTATTC
GCGCCAAACGTGTGGTGGTGCCTTGGATTGTTGAGCGGAGCAAGATCTGGGGTGGCGACACGGAGCAGCGCAGCATCCAGGGCATGCTACCGTTCTCAGC
AAAGTTCATGTACCGCAAGATCTGGCGGCCGTACTTCATGAGCAACGTGGCAGTGGCAATGAAGAACTTGAACGAGTTTGTTAGCGCTGCAGACTCGAAC
GGCAGCGGGTCAATTTACAGCGAGCGCCATGGCGAGATGTGCACCGTAATGTGAAGTGGTAGACTACCACTGGTAGCGAGGGGGGCAGGCAGGGCTCGTT
TCTTTCGTTTCTGGGCTCTACAGCTATTTATTTTATGGAGCATCGAGTGTGTCGTGGCGTGCGTGACCTGGGCTAGCAGAGCGAAACCAAAGTAGCGAGT
ACCAGCAGCTTTCTTATGGTTAATACACAGCAATTCCTGCAGTATTGACACGGGGTCAGCTAAAGCGACGTTGAAGTTCTTGGTTAATCGCATGCATCGG
TCGGTCGTTACACAAGTTGCAGTGGTTTCATGATCGATCCCCCGCCCGTTGAAAGAGCGATCCCATGTGCCGCATTGTTCTCGTTGGCACAAAGCGTTAT
TCGCAACATGACTGCTCTTGCGAAGGATCACGAGAAGATCGAGGCGAACTGCGAGCCCGAGCAGCAAGCTCCTCTGGATAAGCTGGACCAAGATGATAAC
ACTCAACCAGACGAAGACGATAACCAAACAGCAACTTCCTTCTCCGCGGAACTGCCGAAAATTGCCTGGGAATGGATCTGCTGGTCCGGTGCCAAGACGT
TCGACGGCATGGACTTTGCAGGTGAAGTGCTCGCGAACTTCCTTGGGCTTACGCAATCGAAGTACCGGTGGATCCTCGACGCCCAAGAGCGCGAGGAGGA
GGAAACGCAGCAGCGCCGACTGGAAAAGCGACAGCGTCGCCAACTTCGCCTTGAGCAGCTTCTTGAGGCCGAGCAGCGGAAACTACAGGAGCTTGAGACT
GGTGCGTTAGAGCAAGACGAGGAGTTATTGGAGACATAACCAACTGTGTAGGATTCACCTTGTACGGGGCAATACACATACACAAGTGCTTCCCCTGTCT
GCGTGAGGTGCGCGTGTTGTTGCATTGTCAGGCGAATGAACGGAGAACTCGGATCATTTACATTGATGTTGAAGTCATCTCATCCTACCCCAAAACGACG
GCACAAAATCAGTGGTTGCCAGTAACAAGCTGCTACTAGCAACGTGAGTCTACGTGTGCTAGGAGGCAATACGTGCCGATCGCCGTCGACCCATAGTGGC
CGTGGCTTCACTGCTTGCCATCGATACTACCCCAAAGTGGATGTGTTGGCGGCTTAACTCCAGCGCGTACCAGCATTCGCACAGCTGCCTTCTCGATGCG
TTGCAGCTGCCGATTTACGACACTTTCGCTCTCGGGAGTGAACTGCTCGGTACGAATCGTAAGAAGTCCTGCACATCATCAGCAACAGTCAGAACCTCGT
GGAGCTGGACACTCGCGTAGACAACAGCCGCAGCAACAAGTCGCACCGTTCAGGTTGCCAAAGAGCACGTCCGTCGAGTATCGGTCTCCAATAACGACAA
GCGTCTCAGGGTCTACTTCTCCAAAATGTTTCTTGACAAATGCAATGCCTCCAGGTTTCTGCAATCACAAGCAGCTCAGCCACCCACTCCATCCAAGCAT
CAACGCCGCACCCATTTATTACCTTCTGGTTGTGACGTAGCACAGCTACTTGGAGGCGTTCCTCGATTTTCTTGGCTTCAACGCCATCCTTATCGTCCGT
GGAGCCCGCCGAGTTGGAAAAGATCACGACGCCTGAGTCGCCAAAAACTCGGCGGCATTCGGCCAGCGAAGACTCGAGATGCGGCGCAATCTCCAATTTA
TGCGGCACCGTCAATGTGTTGTCCTTATCGAAGATAACGCCGCGGAATCCGCGGTCCCGTAGCGTCTGGAACGGCACCTCCGTCACATCTGAAGCAGCGA
TACGAGCAGAACGTGCACAATGAGCGACATTTTTCACAGTAGTATTATTCCGTACAAACTGGTCAGATTCACACTATCTTTGCATGTGTTTAAAGCTGGG
AGAGTGCAGATCACCTTTCACGGACAGTTGGGGCAGCAGGAGCTGCGGCTGGCGCGTCAGCACGCGGCAGAACTCCACGACGCCGCCGAGATTGAGGCCT
TTCATGATGCTGCGCTGCTCACCCCAAAAAGCAATGGCTTCACATTCGGACCAATCCAATCGCCAGATCTTCAGTTAATCCCACCATTCGTCAATATGCA
GGTCACTTTCTACCAATGAAACGGCACTGCCGTTTCGGCAGCCAGTGACGAGCTCAGAAATACTCGCTCTCCGTCACCCGCAAGACGCCCGAGCAGGTAT
CGCTCCTCCCACTTCCCGGCGCTGTAGCTTCGTCGTTGCGCGACCTGCTTCTGTTCTCCCACCGCGACGTGGTTGCCCTTCTTCTCATCTTGCTTTGACA
GCTTTTCCCAGCGAATAAAGCCCCATAATGGCCGAGAACCCGGAGGAGACGCACATCCACGACGAAGAGGAGGACAAGGCCGATAACTCGAGCTCCGACG
ACGACTCATCCTCCTCCAGCTCGGGATCCTCGTCCTCGTCTTCCTCCTCTGACTCGGAGTCGGAGGACGAGGCTGAGACAGAGAACGCCAACGCCGGCGC
AGACGCCAGCGGCTCCAAGCACGCCACTCCTCACGGAGGAGGCATCGCCAGCCGCACTGGCCATGGCTACCCCTCCAACAATACGGGCCCGGCACTGTCT
GCGCCTCGCCCTCATGGCCTCGCTGCGACTACGGAGAGTCTGAACGTGAACTCGACGCGAGCGGCGGCGAGATTTAAAGCCTCAGAGACAGAGGCGATGA
TGCCGCTGGGCACCCGCAAGCGCGATCGACGTACCATCGAGGAAATCCAAAGAGACTTACGTGATAAGAGGAAGAAGCCGCTGGGCGCCCCCGCTGCGAG
GTCCAGTCCTCCTCCGCCGAAAGGATCGCCGGTGAGGTCTCCAGAAGCCGAAGCTGTGGTGAACAGCGGCGCTCCGATGGCTGTGGGTGGTCCGCTGGGT
CAGTTCGGAGCAGTGGGACGACTGCCAGTGAAGAGGAAACCAGTGTCGGCACATGACAGATTGGCGATGAAACTTAATGGACGCAGGACCACCAGCGCCA
AGGCGAAGAAGCCCGCCAGCTCGACTGCTGGAAGCACCACGGTACCGCCGGTTTCGGTAATGACCAACAAAACTGTTACGAAGCCCATGACTGCGACAAG
TTCAGGGGGAATCGCTACAGGAAATAGTAGCAGCAGTGATCATGGAGGGGATGCGGGGGGCGATGGATATAGCAGCAGCGTGAGCAAGTCGTCAGCTCCT
GCAGTCGACGGAAAAGTGGTTCGCGCGATGCTTCGTGCAATGCTTCGCTACGGAGACCTGACCGATGTAGGTCTCTATCCGAAAGCCGCGAATTTCGCAG
ACGAGTACAAGATGCCTAGCTTTATCGAGCGGTCAAATCTGCAAGCGACTACCAAGGTCTCCATGGATCGGCTGCAGACTCTCGCGAATGATGTCGCTCA
GAAAGCCAAGCGTGCCGTCGAGGCACGACCACCGCACGATAACATCAAGATCGCTGAAGTGGAGGCTCGATCGTCACAGATTATTGAACGCCTATACGAG
AACCTCAAACTCCGGGTCGCTGTTCAACGCGCATTGCGGACTGCTGGTTGCTCTTCAGGAAATGCACAGGCTAATGCTCAAGGGGCATATGTATTGGTGG
CGAAGCAGAGCGATCTCTCCGTGTTGGGAGTTCAGACCCGGGACTTGCCGAGCTGGACTTGGGCTGAAAAGGAACATGACTGGTCTCAGCGCAAGGATGC
AGCGTTGCTTCTTGGTGTTTACGTCCATGGATTTGGGGGTTGGGAAGACATCTTGAATGATGATTTGCTTCACTTCCAAGGGCAACGAGCTCTAAAGGGC
GAACGCCTAAAGAAACGTGCTGAAAATCTGCTGAAGCGCCTGCCTGCACCTGATGTGGACGCTGGCGATCCACGCATTGTCCAACTCGCTATCTCGCTGA
GTTCTGCTGGTGCCAACTCGAATCAGTCTTTGGGTGCGCAATTCAGTGCCATCATTCATAGTGGGGCCATCGCTGGAGTTACAACATCAATCCCCGCTGT
TCCGGCTACCGGTGGAGGGCGAATGGCGCGTGCTGCGGAGCGATTCGCTGCACGGCAACAAAATGAAGATACACTCGCCCGCCGGCACGTTGGGCTTAGC
AACGGAACTTCCACATCTAACGGTCAGGGATCGGATTCGGGGCGGCAGCACAAGACACCGGTCATGAGATCTCCTGCGCAAACAAGTGCTGTCGATAATG
AACCAGAAGAAGGAGAAATTGGAGGGGCGTCGCCGACGCAGTCAACATCCTCGCGACATAAAAGACGTTCGTCCTCGGCGGAGGATGAAGATCGGGCATC
GTCACGAAAGAAACATCGCAATAACAGCAGTGATACTCCAAGTAAGAAGGAAAAGCGGAAGAAGGAGCACCGAAGAAGTGACCAGCCGGAGGCCCCTGCG
GTGGTCGCGAGTACTGTGAATGATGTGGCCCCGTTGCCACTGCTTTCGACTGACGAATGCTATGAAAAGTGGAAACCGAACAAGAAGCTGCGCGAAATCC
GGCAAGTGCTGAAAAAGATGAAGATAATGGCCGACTGGTCTCGAAACCAAAAGGACGAGACTGTCGTTGAGAAGGTCTTCAAGTATGTGAGTACCATCGG
GGAAGAGATCGATCGCATCGTGACACAGCACCAAGACAAGGAGGAGCGGCACCATCCTAACGCGTCGTCTCGCGAGGTTGACGAGCTTTGCACATGCCTT
TGGACATACGCCGCGGGCTTCACCCCGTTCACGCCCCAAGGTTTTGAGCGCCTATACGACGACATTTGTGCGGATGGGGATGCTCTTGTCGCAGCCAGAT
CATGACGCGCTTCACGGCGACCATCGCGGCGTGAAAAGTGATGTCAAGGAAGCTGTGCGCCGGACACCCAGGTGCGTTGTCTCAACGAACAGATAAACGT
ATCAACAAGATGGACTGCTTCCAGGTTGCGGAATGTCAGCATGTATCGGCATTTTTATCGTTGTGTTGACCGTTTCGGTCGCTACAGACGCCTTCAGCGG
TGGCCGTTTGCACTTTTGCGATTTGCCGGTTCGTGTCGGAAGGAGCGCCCTCATGATGTCTGTCTTGCCGACATTGCTGCAGCCTGCACCAACGGCGGAG
GAGCTGGCGCTCAAGGAACAGGTTACTCAGGTGCTAACAAGCCAGGGCGTTCTAGCAAAGTTGAAGGCAGAGCTACGTGCTGCAGTTTTTGAGGTTATGC
ACGAGCGAGAGGGTTTCGCGAAAACGAATGACCCTACGGCCCCAAACTTGAGCGACTTCCCCTTGGAGACCAGGACAACTGCGTTGGCTCTGATTGTCGA
GTGTCTGCAGTTTTTCCACTGGGAGCACGCGTTATGTGTTCTGCTCGCAGAGACCAATGCAGAAGATGAACCTTACGATAGTGCACAGCTGGTTAAGAAG
CTCGGGTTAGGAAGTACCAACTCGTCGGCCATGCCGACACTGTTTCAGCTCGTCGAGTCCAGGGTGCTAGGCAACGATCAGAGTGATCGGTTTATCAGGC
CAGCGACGACCATCAAGCCCGATCAATTCAATGATGGCGAAGAAAGTGGTGAAGAAGCCACTGTGCATGCAGGCGACGTAGCACGGAAGGCGCGGCCATG
GGAGCGAGACGACGATACGCACTCACTACCTGTAAAAGAGCCCGAACCAGCCCTGATGCAGCGTAAAGATGAAGATACAGATGAAGGCAAAGAGGAAGAG
GTTGAGAGCAGCGCAGAGATCGAAGAGAGCATGGCGGAAGAGGTACCAAGTGGATCTGAACTGGAGGAGTCGAACTTTACAAACTACGAGGATGAAGAAA
GCCAAGACTACCGTGCCCAAGCTAGCACACAACCCACTGATCTCTACTCGGCACACCAGCAAGAGAAGTTTCAGGGTGACAAGGACCAAGAAGAGAGTCA
TGACAAGGATACCCACGAAAGTAACGACGACGATGCCGTGTCACTAGCAGCTCCTCCTCCAGCACCCGCAAAGCTACCTTCTTTGCCACCTCTAATGAAT
ACATCAAATGGAGCCAATGCTGGAGATGCAGAGGACGATTTCGATGCGGTAAGAGCGGTTGAGATATTCACGGGTTTTATTGTGGCCTAATAGTTATTGT
TTTGCCTTGTGTAGGAAGAGGAGGCCGAACGGTTGAGGAAGCTAGATGCAGCGTTGCAAGCCATGGAGGCGGAAGACGACACAGGCACTCTCCAGCAATT
GAAAAAGTCGCTGCAAATGGAGCTCCAAGAGCAGGATAGTTTGGTGAGTAGTGGGGGCCCCGGCAAAGCGGATGAGGATAACGATGACGCAGACGCTGAG
CCTCAAGGTAATAAGAGCGAAGATGATGATGAAGATGACGATGGATATGGAAGCAGCGACTTCGAAGAAGAGGAAGAAATTGCCAGGTAAGGAGCAACCA
CGAGTACTGTTCCAAGTATGCTTCATGGCGTTCATGGTTTTCTATGCTGTTTGGTCCCTACAGCGAGATTTCCGAGGAAATGGAGTCCATGCCAGAGCTC
TCGGATAAAGAAGATGAAAGCGAAGACGGAGCAGCCACGTCGGCGGCAGAGATCGAGCCACCTAGCACCCTTCGAAACGATACCCGGGTTGACAGTGAAG
ATGCGTTGAACAGCTACGACTACATTGAAGATGTTGAGAGAGGTGGGTGGTAATAACGCGCCCGTGGAATGGTATCATCGTCGTAAGAAATTCACAAGCA
ATAACAGCGTAGGTATCAAGCTGAAAGCACCCTCTTAACTCGATAGCTCTATATCGCGTTTTCGCCCTGCACAGGTTGAGATCGCTCGCACCTCTAGTTT
CACTTGCGCTTTCCAGCTCCAACGAGCTTGTTCAGTAGGTTCTGGTCCTCGAAGGCCTCCGGGTGAATGAAATAGTGGCGGTCACGGGCCTGGAACGACA
CCATGGGGTGCATCGCCTGGGTAGGAGGTGACACGTCGGATAGCCGGAACGAGCTCTTCTGCAGCTGAGCGAACAGCGTCACGGTCTCCACTGTCACCGT
GGGGTCAGCATCCCCGACAGCAGGCGCCGTCGACGAGTCGGTCAGCCACATTTGCATCACGTACGGCTTGAACAGATAGTGGAACAGCGACGTCGTGCCC
AAGCCGAACAGCATGATGGTGCCGCACATAGCCCACTAAACGAACAGAGAACGAATTGCATCAGTACAAGTTACCATCGACACCAGTGCTTTATCTACGC
CCCTGTCGATGTGCGCTTACCTTGCCGATCGTGGACGTGTCCTGCTCGCTCAGCACACAGAGCACCGGCATGCCGATCGAGGTGAGGGTGCAGCTGGTGA
CGGACACCGCCTTCATGAGGCGCACAGCACGCGACATAGGCGCCTGGTAGACCTGTGCACCTTCCAGGTTCGTAGCATTCAGCTCCACCTTGTCCTTGTT
CTCCTCACGCGCGTCTTCATCGGTCTGGGATGAACTGAAGTGGCGGACAGTGAACGGTCCACTGAATCCAGCGCTGCGGCGGCTGTTAATCTCGAGCGAG
AACCGCTGGAGCGTGGCTACGTTGGCGGGACGACTGGCAATACGGGAGGCCGTGTGAAGCGACCGGAGAGCAGGAGACAGCGCCTCAGCGAGCCGCGCTG
CGCGGTGCGATGCGCGGAACACCAACATCGTGAATCTGTGGCTCTGTGGCTAATACTAACGGGATTTTTACGATAGAAATGCAGTCGTCGTCACCTTGAA
ATTTATGGTATACTGAATATTCACCGGTACACGTAGCGGTATTTGTATGTTGTCGCGCGAGTCTGTGTACTCATGCTACAGAATAGTAAAACCCCGACTG
CTCTGCTTTCAACGTACGTGAAAATACGACGAACGACTCATTTGAAGCGCTGCAATCCAGCGTGGGCCAATGTCCAATGGCTCTGATGCGCGTCCAGCTG
CCGACTGGCCTTAAATCTGGCCGAAGAATCGCGGTTTAGTGGGCCGAAGCAACGGTTGCATCATAGTACCGGTGATCCAGGTGTGTGTGGCTTGCCACCG
CTTGGACAGAAAAGAATGTACTGCATCCACATTGCCATCTCGCCGCGACTTGCCTTGCTTTACACGGTACAACAAGGTTTTGTACTTCCGAAAAAGTATG
GTTTCCGCTCTTACCCCGCTTAGGTTCATACCTAGACTTCGTGCCACGTTGCAGCATACAAATGACGCAGTTGAAGTTTACTTGAGCGGGGTCGCGAGCT
TGACGCATCTCGCCCGGCTATGTTCCAAACCAGTTGGCGGTTGTGTGGCGGAAGCCGCCAGCTGGTGTTTACTAAAGTCGCAGGCGTAGTCAGCGGTGAT
GCCCGCCACGTTGAAGCCTCACTTTGGGGCGCCGCGGGCCATGCTTGCATCGTCGACTGCACCATGGGTTCGCATACCATAGCGATTTCTTGACGTGAAG
CAGCAAGCGCAGGAGGAAAGAGCAGGAGAGACAGGGCACCGTCCCGCCACCGACCCTACGCTCTCCGGGCCGATCCAGATGGCTTCGATATTTCTTTCGT
GTCTTGCGCGTGGTATCGGCAATGCCAGGTGTGCTCACTTGCCTCGGTCTCCGCTTGGCTTTGGCTCGGGTTTAAATCGGCCGTCGGCGCCACGCGCTGC
CGAACCGAAGCTCTATTGCACAACTAGCACTTCATGTAGCGCCTCAAACTGGCAAGCCGCAACGCGATCGCTTTGAGCGTCAGCCGATTGACTTCCGAGC
GCTGGTGCAGCTTCTTTTCGCCGCCGGTCACACGTTCCAAGTTGAAACCACGGCGAGCTTTTCCCTCCGGTTTTTGTCCAATACCCGGAGACCAGCGAGA
AGAACAGCGGACGATACCTACACCAAGATCAGCGCGTCCACCGTCTCCACCCAACGCTCGCAGTAGCTCCGCCCACTCGCGCTCTCGGCCAGTTGCAGAC
TTGTGGCTTGCCCCGTTCGCGCCAGCTGCCACCAAAGATGCAGTCACAGCAGCAGCAGCAGCCTCGACAGGGCGGGTCGTCGGGCGGTGGTGGGGCAGCC
CGCCGATCGCTTGTGAACCCATTCACGACGCCGTCGGGGGGCTACCAGCAGCAGTCGAGCTTTTTGCAGTACCCCGCGCCCATGGAGCCTTCTTTTCGCA
GCTACGGCCAGCCACAGCAGCCCCCGGCGTACCACCAGCAAATCTCCGGACGCTATTGGCAACCGCCAACGGGCGTCAACCCTTCGTCGTCAAGCGCAGG
AAAGCAGCGTCGGCACGGCGGCAGCTTGGACTTAAGCGAGTTTAGCGATATTCTGGACACCAACTCGGTCCGCAGCGGGGGCGACGCAGCGCCGGCGCTG
GGGGGAGCGCCGTCGGAAGCGGCGTCGGAGATGAGTATGGCCAGCTTCGACGTCCAGTCTTTCCACGACGGCATGACGGGGTCCACAGGCGGAGCAGAGG
TGGATACCGCTGGGTTTCAGTCGGCAGCGCGGGCGACAGGGTCGACGGCTCAGAGCTCTGCGGCCAGCAAGGCACCAACGAGGACAATGCGTGCTTCTGC
TGAGCCAGAGACCATGTCGTTGGTGGACGCCGCGTACATGCCGTTCAATGAGTCGTGCGTCGAGCCCGACCTGACGACCGAAAAACTCCCCAAGGACAGG
AACGAGCGATGCCAGTTCTACGACTGCCCGAACCGAGCTCGAGTTTCACAGTCGTACGGCAATTTCTGCAATCGCCACGTGATCGTTGCCCCCTGTGGCT
TCCCTGGTTGCCGAGATAAGGCCATGGAGCGAGCTGCAATGTGTGCGAAGCACATGGAGTTGGGCAAGCAACCGCTGCAGGCGATCTTGGATGCTCGCAC
GCAAAATGTGCTGGTGTGCAAAATGTCTGGCTGCTTTAAGAATGACCAAGGCCGCGGGTATTGCCGCGGACACGAGAAATTACTGATGGCCACCGGACGC
CTGCCGGCTCACATCAACAAGCGCCGGCTCAATAGTGCTTACACCATGTGCAGCTACCCCGACTGCAATAAGCACTCTCAGCGACACCATTTGTGCCGAA
CCCATGGCAATTTGATCATCAAGGAAGCCCAAGAACTGGCCAACAGACCCGATGCGTCAGAAAGCTACGAAGAAATTCTCAGCAGGATGCAAAAGGACAT
TCGGCGATGCACGCACGAAAACTGCACCAAAAACTCGCAGCGAGATCGACTGTGCACTGTGCACTATTACGAGAAGCACCATTTGCGAAAGGATGGGTCG
ATGCCGGCAAATGCTGCCTCGGATGAAGCGTCATCGAAGGAGAATGTCGATTCAAGTCAACTAGAAACAGGAGAGCGTCGCGGTGGGAGTGACATTCGAG
ATGTTGAGCGGACACGCTGTGAAACTCCTGGTTGCGGGAATCTGTCGTACGCTGCGGGATTGTGTGTTGAGCACACTAAGGAGAGCCAAAACCTGATGAC
GAGTCAAGGACGGTATGATGACCCATTTTCTTCTGAAGGAGCTAGTGGCATTTTCTCCACTGACTTGGAAAATGAAACGAAGCAGGGTTTGTTCAGCCGA
AACCGAAAACCACAAACTGTTGCTTCTCTCGCTTCAACGAGCGCACCCCCACTGACAAATTCCGGTCACACGAAATGCACGAATCCAATGTGCGATCGAG
AAAGCTACGGGCGTGATTACTGCGAGGCCTGCCAGAGACTGTTTTCCCCTCTTGTGATCGCTATAAATGATGACTCGGCCAGTTCGTCTGGATATCCATT
CAATAGCTCGAGCACTGGTATCGGCCAAGCTGAAGAAAAAGTATCGTTGTGCCGTGTGAGCAACTGCAAGCAAGATGGTGTCCGCGGCGGGCTGTGTGCA
CTGCACCTTCGGGCCTTCAAGACGGGATCATTGTCAGTGGATAACTTGAAGCTGGACTCGCAGGCACAACAACTGCGGCGTGAACAGGAGCTGGCGGAAG
CGGCGGCGGTCGCTGCCGCTGCGGTAGAAGCCAAGCAAGCAAGCCCCTCTTCGTCGGCCAAGGCGAGGAAATATTACTGCAAAGTTGACGGGTGTGATAA
GCAGGCTCAGAAACGGAACTTGTGCAAGCGTCACTATCGCCAGCAGGAGAGTCTTCCTACAGGAAAACCGCAACCAGAAGTTAGGCCAAGCGGTTCGACG
AGAAACTACCTTCCTCGGGCGGAGCAATCTGACTTTCCTCAACCAACTATAGCGTGTCGCTTTCCTGGATGTTCGCAGATCGCGGGTGGTGGTGGTGCTC
TGTTGTGCTTGGCGCACTCTAAGGCGACGTTTTGTTGGCAGCCAGGATGTGAAAATCTCGTGAACCACCAGTGCTTCTGTGACTTCCATGCGTTTCGGCG
GCAGTGTGCCTACGAAGGCTGCATGTACACGGCCGAACGAGACAGCAGCGGCTGCATGAACCACGTGCTGGCGCGACGGTGTCGTCACGAGTTCTGCGAT
AAGTTTGCAGTGGGGTTGAACAGTGATTGGTGCCGCCTGCATCAGATTAGCTGCCAAGGCTCTCCGTGTACGCTGTGCAGACTGCACGCACTATCTCTGG
ATGGGCTAGCAACAAGTGAAAACGAGAATAGCAATCGGAGTCGCTACAACGCGGCGTCAAGGGGACTGCCAGGTGGAGGCAGCGGATTCAGTGATGACAG
CCCATTCAGCCGCAACTCGCGCTTGATGTAGG