Description :
From Genome Similarity Track
Location :
Scaffold_155:5782- 8191
Transcript NameFunction/comments
Phyag_g2826hypothetical protein
Phyag_g2827conserved hypothetical protein
Phyag_g2828conserved hypothetical protein

Sequence
2409 bases(100 bases per row)
GAGGCTTCGAGcgcccccaagaagaagaagaacaagagcaagggcaagaagaaggcgcctGCTGCGACCACCCCcgtggacaaggagaacaCGTCGTCGG
AGATTAACCTCGAGGAGTTCGTCGACGTACGTGGGCGGCTTTTTGACACGAAGAGATGTTTTATTTACATTTTTTATTGATTTTGTTTTACTGCTCAGGA
CGGCCCggactcggaggaggaggaagctaTTCGTgcggagaagcgcaagctcaagcttaagcagaagaagaaaaacgccaaggccaagcagcgcgcggcg
gccacgacgacgggCAAACCCACTGTGGAcacggacaaggagaaggagaagaagaaggcggctgcggctgcgctcaagaaggacgcCGAGGACGGATGGG
AAACGGtcgtcaacaagaagaagacctcCAAGCCCAAGCAACAGTAGACGCACACGACATGACGACGTGTTGACGCGCCGTCATCGTCTCCCCCCTGATA
GTTGATTTTCCCCACTTTCTCGACTCCTTTTTGGACGACGGAGAGATGGAGGGCCAGCATGCAATTGCTTGGCGCTCCTGTTTTTCTTCTCGTACGGCAA
CGAGCAATTATGGTATAGTAAGAACAAGGCGTGGTTCGCGAGAGCTTCATGCTTTGGACACAAAAAAATATACGAGAATACTACCACGATGAACGTTTGA
CTTGCATCGATCGATGTGAAGGATATGGAAAATGTGTTTTCATTACGCGATTGATCGTTGTCGTAGCGTGCATTTATCTGCAGCTAGCACTAGATGACTT
CGCGAGCAACTTACAGCTTCGATTGCGGCTTGAGCGCGTTGAACACGACCGGCAACTTCATGGCGAGCGTCATGTTGCCCTTGAGCTTGAGTTTGCCCTT
CATAAACGCCTGCAATCATTAAAACACCAAGTTAGACCACAACAATACCTATTACAACGTCTATACTGCAACCTACCTGCTGTGCGTTGAGCTTTCCCAG
GGCAATCGCCACAAAGTCGGCGTCGCTGACGGTGATCGTCACATCAGCCTTCTTGGATCCCTCCGTAAGTGCGGGCGTGGCGCTCTTCAGGTCCAAGTTC
CACTGGCCAGCTCCCGTAATGTCGAACTGGATGATGCccttgaccttcttggccatcgcagcgccgtccttggccaccacgtcgcccagCAGACGGAAGA
TCTCCTTCGAATTGAGTCCTCCACTGGCcgccggagcagcagcagcagcagcagcagctggcttggctgctccagttcctttcttcttcatgtagtTGCG
AGtggccgccagcaccacgttgaGCTTCATGGCGAGCCCCATGTTGCCCTTGATCTTCACCAGGCCCTTCATGAACGCCTGCTGCGGGTTGAGCTTGTTG
TCCATCATCTTGAGGAAGTTCTCCTCGGacagagtgatggtcaggTCGGCCTTGTCCATTGCCGTCGCGGTcttgacgctgcctttgccCGTCTTGAGAT
CCACGAGCCACGCGCCCGCGCCCGAGATGTCGAACTTGATGACGCCCTTCACTTTGCTCACGAGCGACGGACCCACTTCGTCCACAGCGCCACTCATCAT
GTCGAACAGCTCGGCGGCGCGTGGGGCCATGGCGActaaagaagaagaggaggaagaagaggaggaggcgtaGACGACACCAGGCAGCTTTTTGCGAAGT
GAAGTTGAGTCCGGCGTGACGGTTGAACCAAAATCACAATCAGGTTTGACGGAGTTCGACAGTCTGTCTATTACGATGTAGCAGTATTTTTCAGCACTTT
TTGTATATTACGCGATCGCATACTTTAATTACTCTTATTCCTGCTAATCGTTTGTTATTAATGCATATCGGATTATTCAATTTTACAGGTATCGTTATGT
AGAGGTTTAACGCACTGAAACTCGGGATGGTCACTGTGCGAGCCTGTTGATACAGGGACAACGAGAACAGGTTGCAGCACGGCGAAAGTAGCCCTTGAAG
AGCTTACAATCCTCTCGCGAGTTGTACGCGTGAGGCGCCGGTCGTGGCCTCCCTCCTCCCTCCACTTCCATCAACTGAAAACGTACTTAGCCGAAATTCA
TAATTTGAAACCATTTTGCATTATGATCGGCCGAGAAGCTCCATTAGCCGAGTTAACTCGCGCCGCGGGGCTGCACGTCGCCGTGTTCgagtctccagcg
ccgcttGTGATTGTGTATGGTGGCGCGTCCACTGGCAAGAGCATCGGCGTGTCtcaggcgctgcagacgcaccCAGCGCCCCACGCACTCGTGGACTGTA
CAGCTCTCTACTCTGTCAAGGAATTCTACCGCGAAGCATTAGCACagctgcacgacggcgcGTCTGTTGCCGAGTCGGAGGACGTTACAGTCGTAGTCGG
TGCTAAAGA